ID: 1051713799

View in Genome Browser
Species Human (GRCh38)
Location 9:19960498-19960520
Sequence AACCTTGGGCTGCTATTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051713795_1051713799 -8 Left 1051713795 9:19960483-19960505 CCCTTGTGAGACTGGAACCTTGG No data
Right 1051713799 9:19960498-19960520 AACCTTGGGCTGCTATTGTGTGG No data
1051713797_1051713799 -9 Left 1051713797 9:19960484-19960506 CCTTGTGAGACTGGAACCTTGGG No data
Right 1051713799 9:19960498-19960520 AACCTTGGGCTGCTATTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051713799 Original CRISPR AACCTTGGGCTGCTATTGTG TGG Intergenic
No off target data available for this crispr