ID: 1051715453

View in Genome Browser
Species Human (GRCh38)
Location 9:19978269-19978291
Sequence CATCTTTAGCAAAAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051715450_1051715453 2 Left 1051715450 9:19978244-19978266 CCTGCATCATATGATCATTCAAT No data
Right 1051715453 9:19978269-19978291 CATCTTTAGCAAAAGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051715453 Original CRISPR CATCTTTAGCAAAAGGACAG AGG Intergenic
No off target data available for this crispr