ID: 1051718231

View in Genome Browser
Species Human (GRCh38)
Location 9:20008195-20008217
Sequence CAGGCTTAAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051718231_1051718239 18 Left 1051718231 9:20008195-20008217 CCCTCTTCCCTCTCTTAAGCCTG No data
Right 1051718239 9:20008236-20008258 TCCCCACCCCTATCCACTTGTGG No data
1051718231_1051718241 19 Left 1051718231 9:20008195-20008217 CCCTCTTCCCTCTCTTAAGCCTG No data
Right 1051718241 9:20008237-20008259 CCCCACCCCTATCCACTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051718231 Original CRISPR CAGGCTTAAGAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr