ID: 1051720695

View in Genome Browser
Species Human (GRCh38)
Location 9:20034156-20034178
Sequence GTGTAGATAATCAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051720695_1051720701 9 Left 1051720695 9:20034156-20034178 CCTTCCTGCTTGATTATCTACAC No data
Right 1051720701 9:20034188-20034210 CTTACAAAATAGTTTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051720695 Original CRISPR GTGTAGATAATCAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr