ID: 1051721608

View in Genome Browser
Species Human (GRCh38)
Location 9:20042886-20042908
Sequence TCTTACATGGGCATGGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051721608_1051721614 30 Left 1051721608 9:20042886-20042908 CCACAAGCCATGCCCATGTAAGA No data
Right 1051721614 9:20042939-20042961 ATTTTAATGGCTCCAATGACTGG No data
1051721608_1051721613 17 Left 1051721608 9:20042886-20042908 CCACAAGCCATGCCCATGTAAGA No data
Right 1051721613 9:20042926-20042948 AAATGTTATGTGTATTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051721608 Original CRISPR TCTTACATGGGCATGGCTTG TGG (reversed) Intergenic
No off target data available for this crispr