ID: 1051730701

View in Genome Browser
Species Human (GRCh38)
Location 9:20139894-20139916
Sequence GGTCAGGGGCCTGGGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051730701_1051730710 2 Left 1051730701 9:20139894-20139916 CCAGCAGGCCCAGGCCCCTGACC No data
Right 1051730710 9:20139919-20139941 GCTAAGGAGCCCCTTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051730701 Original CRISPR GGTCAGGGGCCTGGGCCTGC TGG (reversed) Intergenic
No off target data available for this crispr