ID: 1051730872

View in Genome Browser
Species Human (GRCh38)
Location 9:20141351-20141373
Sequence CACAAATGGTCTTGGAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051730872_1051730877 -5 Left 1051730872 9:20141351-20141373 CCCTTACTCCAAGACCATTTGTG No data
Right 1051730877 9:20141369-20141391 TTGTGGTCGTCTCATTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051730872 Original CRISPR CACAAATGGTCTTGGAGTAA GGG (reversed) Intergenic
No off target data available for this crispr