ID: 1051734645

View in Genome Browser
Species Human (GRCh38)
Location 9:20186082-20186104
Sequence TAGCTCACTTTCTGAGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051734639_1051734645 -6 Left 1051734639 9:20186065-20186087 CCATGATGAGGCTTCCTTAGCTC No data
Right 1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG No data
1051734637_1051734645 16 Left 1051734637 9:20186043-20186065 CCTTGGAGTTCTGTCTTGGGTGC No data
Right 1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051734645 Original CRISPR TAGCTCACTTTCTGAGGAGG GGG Intergenic
No off target data available for this crispr