ID: 1051741577

View in Genome Browser
Species Human (GRCh38)
Location 9:20257772-20257794
Sequence TTGAGGGTTTGCTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741577_1051741588 27 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741577_1051741581 9 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG No data
1051741577_1051741589 28 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741577 Original CRISPR TTGAGGGTTTGCTATGTGCC AGG (reversed) Intergenic