ID: 1051741579

View in Genome Browser
Species Human (GRCh38)
Location 9:20257788-20257810
Sequence TGGGAACCATTATTTATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741579_1051741589 12 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741579_1051741590 20 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741579_1051741588 11 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741579_1051741581 -7 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741579 Original CRISPR TGGGAACCATTATTTATTGA GGG (reversed) Intergenic