ID: 1051741581

View in Genome Browser
Species Human (GRCh38)
Location 9:20257804-20257826
Sequence GTTCCCATCCCCTGAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741579_1051741581 -7 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG No data
1051741577_1051741581 9 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG No data
1051741580_1051741581 -8 Left 1051741580 9:20257789-20257811 CCTCAATAAATAATGGTTCCCAT No data
Right 1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741581 Original CRISPR GTTCCCATCCCCTGAGCCTC TGG Intergenic