ID: 1051741583

View in Genome Browser
Species Human (GRCh38)
Location 9:20257808-20257830
Sequence AAAACCAGAGGCTCAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741583_1051741589 -8 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741583_1051741590 0 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741583_1051741588 -9 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741583 Original CRISPR AAAACCAGAGGCTCAGGGGA TGG (reversed) Intergenic