ID: 1051741588

View in Genome Browser
Species Human (GRCh38)
Location 9:20257822-20257844
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741583_1051741588 -9 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741582_1051741588 -8 Left 1051741582 9:20257807-20257829 CCCATCCCCTGAGCCTCTGGTTT No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741580_1051741588 10 Left 1051741580 9:20257789-20257811 CCTCAATAAATAATGGTTCCCAT No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741577_1051741588 27 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data
1051741579_1051741588 11 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741588 9:20257822-20257844 TCTGGTTTTTCTAAAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741588 Original CRISPR TCTGGTTTTTCTAAAACGAG TGG Intergenic