ID: 1051741589

View in Genome Browser
Species Human (GRCh38)
Location 9:20257823-20257845
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741583_1051741589 -8 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741580_1051741589 11 Left 1051741580 9:20257789-20257811 CCTCAATAAATAATGGTTCCCAT No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741579_1051741589 12 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741577_1051741589 28 Left 1051741577 9:20257772-20257794 CCTGGCACATAGCAAACCCTCAA No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data
1051741582_1051741589 -7 Left 1051741582 9:20257807-20257829 CCCATCCCCTGAGCCTCTGGTTT No data
Right 1051741589 9:20257823-20257845 CTGGTTTTTCTAAAACGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741589 Original CRISPR CTGGTTTTTCTAAAACGAGT GGG Intergenic
No off target data available for this crispr