ID: 1051741590

View in Genome Browser
Species Human (GRCh38)
Location 9:20257831-20257853
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051741580_1051741590 19 Left 1051741580 9:20257789-20257811 CCTCAATAAATAATGGTTCCCAT No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741584_1051741590 -4 Left 1051741584 9:20257812-20257834 CCCCTGAGCCTCTGGTTTTTCTA No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741586_1051741590 -6 Left 1051741586 9:20257814-20257836 CCTGAGCCTCTGGTTTTTCTAAA No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741585_1051741590 -5 Left 1051741585 9:20257813-20257835 CCCTGAGCCTCTGGTTTTTCTAA No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741583_1051741590 0 Left 1051741583 9:20257808-20257830 CCATCCCCTGAGCCTCTGGTTTT No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741582_1051741590 1 Left 1051741582 9:20257807-20257829 CCCATCCCCTGAGCCTCTGGTTT No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data
1051741579_1051741590 20 Left 1051741579 9:20257788-20257810 CCCTCAATAAATAATGGTTCCCA No data
Right 1051741590 9:20257831-20257853 TCTAAAACGAGTGGGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051741590 Original CRISPR TCTAAAACGAGTGGGCTCAC TGG Intergenic