ID: 1051753649

View in Genome Browser
Species Human (GRCh38)
Location 9:20371052-20371074
Sequence GTTTAAGGAAGTGTTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1304
Summary {0: 1, 1: 10, 2: 82, 3: 418, 4: 793}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051753649 Original CRISPR GTTTAAGGAAGTGTTGTGGC TGG (reversed) Intronic
900315127 1:2052491-2052513 GGTGAAGGAAGAGGTGTGGCAGG - Intronic
900825591 1:4924113-4924135 CTTTAAGGAAGTGTTGAGGTGGG + Intergenic
901289196 1:8109538-8109560 GTTTAAGGGAGTGTTGTGCCTGG - Intergenic
901572635 1:10174097-10174119 ATTTTAAGAAGTGTTGGGGCTGG + Intronic
902055323 1:13595899-13595921 TTTTAAAGAAGTGTTCCGGCCGG + Intronic
903092307 1:20932262-20932284 ACTTAAGGGAATGTTGTGGCTGG + Intronic
903097129 1:20988035-20988057 GCTTAAGGGAATGTTGTGGCTGG - Intronic
903597920 1:24510601-24510623 GTTTAAGGGAATGTTGTGGCTGG + Intronic
903636074 1:24817519-24817541 GCTTAAGGGAATGCTGTGGCTGG + Intronic
904202377 1:28829280-28829302 GCTTAAGGGAATGTTGTGGCTGG + Intronic
904776911 1:32915118-32915140 GTTTAAGGGAATATTGTGGCTGG + Intergenic
904863012 1:33553897-33553919 GCTTAAGGGAATATTGTGGCTGG - Intronic
905086112 1:35379014-35379036 GCTTAAGGGAATGCTGTGGCTGG + Intronic
905545853 1:38800092-38800114 GCTTAAGAAAATGTTGTGGCTGG + Intergenic
905708719 1:40082548-40082570 GCTTAAGGGAATGTTGTGGCTGG - Intronic
906036294 1:42752189-42752211 CTTTGAGGAAGAGTTGGGGCTGG - Intronic
906269814 1:44467600-44467622 GCTTCAGGGAATGTTGTGGCTGG + Intronic
906558814 1:46738396-46738418 GCTTCAGGGAATGTTGTGGCTGG + Intergenic
906838897 1:49114399-49114421 GCTTAAGGAAATGTTGTGGCTGG + Intronic
907548149 1:55280513-55280535 GCTTAAGGGAATATTGTGGCTGG - Intergenic
907916846 1:58878240-58878262 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
908464918 1:64384115-64384137 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
908893635 1:68874326-68874348 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
908975387 1:69890947-69890969 GCTTAAGAGAATGTTGTGGCTGG + Intronic
909029097 1:70517705-70517727 GTTTAAGGGACTGTTGTCACTGG - Intergenic
909088436 1:71195394-71195416 ATTTAAGGGAATGTTGTGGTTGG + Intergenic
909164544 1:72202604-72202626 GTTTAAGGGAATGCTGTGGTTGG - Intronic
909220294 1:72950666-72950688 GCTTAAGGGACTGTTGTGACTGG + Intergenic
909450125 1:75788583-75788605 ATTTTAAGAAGTTTTGTGGCTGG - Intronic
909735614 1:78957520-78957542 TCTTAAGGAAATGCTGTGGCTGG - Intronic
909844081 1:80368425-80368447 GTTTAACTGAATGTTGTGGCAGG - Intergenic
910018695 1:82558219-82558241 AATTAAGGGAATGTTGTGGCTGG - Intergenic
910732718 1:90415715-90415737 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
910782564 1:90955704-90955726 GCTTAAGGGAATGTTGTGGCTGG + Intronic
910845144 1:91598011-91598033 GCTTAAGGGAATGTGGTGGCTGG + Intergenic
910918186 1:92314012-92314034 GCTTAAGGGAATGTTGTAGCTGG + Intronic
910941780 1:92543423-92543445 GCTTAAGAGAATGTTGTGGCTGG + Intronic
911210741 1:95135692-95135714 ATTTAAAGAAGTGTTGTGGCTGG - Intronic
911503106 1:98713374-98713396 GCTTAAGGGAATGTTATGGCTGG + Intronic
911591379 1:99752086-99752108 GCTTAAGGAAATGTTGTGGTTGG + Intronic
911649613 1:100372898-100372920 GCTTAAGGGAATGCTGTGGCTGG + Intronic
911706159 1:101015931-101015953 GCTTAAGGGAATATTGTGGCAGG + Intronic
911759062 1:101595980-101596002 GTTTAAAGGAATATTGTGGCTGG + Intergenic
911897003 1:103448808-103448830 GTTTACAGGAATGTTGTGGCTGG + Intergenic
911955725 1:104232482-104232504 GTTTAAGGGCATGTTGTAGCTGG + Intergenic
911980948 1:104565230-104565252 GGTTTAGGGAGTATTGTGGCTGG + Intergenic
912307210 1:108580657-108580679 GTTTAAGGGAATATTGTGGCTGG - Intronic
912873990 1:113337040-113337062 GCTTAAGGGAATGTTGGGGCTGG + Intergenic
913082977 1:115406854-115406876 GCTTAAGGGAATGTTGTTGCTGG + Intergenic
913207262 1:116551520-116551542 GATTAAGGGAATGTTGTAGCTGG + Intronic
913350625 1:117854821-117854843 GATTAAGGAAATCTTGTAGCAGG - Intergenic
914415180 1:147473805-147473827 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
914774543 1:150724400-150724422 GTTTAAGAGCATGTTGTGGCTGG + Intergenic
914960420 1:152201320-152201342 GTTTAAGATAATGGTGTGGCAGG + Intergenic
915006532 1:152643138-152643160 GCTTAAGGAAATCTTGTGGCTGG + Intergenic
915909560 1:159905185-159905207 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
916468806 1:165101697-165101719 GCTTAAGGGAAAGTTGTGGCTGG - Intergenic
916500156 1:165380271-165380293 GTTCAAGGAAGAGTGGTGGGTGG - Intergenic
916553104 1:165868691-165868713 GTTCAAGGGAATGTTATGGCTGG + Intronic
916948082 1:169749326-169749348 GTTTAAGGGAATGCTGTGGCTGG + Intronic
916969091 1:169990335-169990357 GTTTATGGAAGTGTCATGGTAGG + Intronic
917112094 1:171558984-171559006 GGTTAAGGGAATGTTGTGTCTGG - Intronic
917238938 1:172926069-172926091 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
917562295 1:176171420-176171442 GCTTAAGGGAATGTTGTGGCTGG + Intronic
917613858 1:176716905-176716927 TTATATGGAATTGTTGTGGCCGG - Intronic
917861482 1:179149213-179149235 GTTTAAGGGAATGTTATGGCTGG - Intronic
917993555 1:180410068-180410090 GCATAAGGGAATGTTGTGGCTGG - Intronic
918289955 1:183097847-183097869 GTTTATGGAAGGGATATGGCAGG + Intronic
918392127 1:184076780-184076802 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
918498335 1:185164744-185164766 GCTAAAGGGAATGTTGTGGCTGG + Intronic
918606137 1:186428452-186428474 TCTTAAGGGAATGTTGTGGCTGG + Intergenic
918632502 1:186734762-186734784 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
919123390 1:193368385-193368407 GCTTATGGGAATGTTGTGGCTGG + Intergenic
919160115 1:193818262-193818284 CCTTAAGGGAATGTTGTGGCTGG + Intergenic
919217322 1:194575298-194575320 GCTTAAGAGAATGTTGTGGCTGG - Intergenic
919288269 1:195594210-195594232 GCTTAAGGAAATGTTTTGGCTGG + Intergenic
919335698 1:196229788-196229810 GATTAAGGGAATGTTGTAGCTGG - Intronic
919400995 1:197116291-197116313 GCTTATGGGAATGTTGTGGCTGG + Intronic
919415242 1:197300441-197300463 GCTTAAGGAAATGTTGTGGCTGG - Intronic
919545907 1:198918207-198918229 GCTTATGGGAATGTTGTGGCTGG - Intergenic
920024321 1:202981958-202981980 GCTTAAGGGAATGTTTTGGCTGG + Intergenic
920081441 1:203376584-203376606 GCTCAAGGGAGTATTGTGGCTGG + Intergenic
920120506 1:203653182-203653204 ACTTAAGGGAATGTTGTGGCTGG - Intronic
920662733 1:207931198-207931220 GCTTCAGGGAATGTTGTGGCTGG + Intergenic
920732534 1:208501191-208501213 GTACAAGGAAGCTTTGTGGCAGG + Intergenic
920799741 1:209174775-209174797 GTCTAAGGGAATGTTGTGGCTGG - Intergenic
921204146 1:212833701-212833723 ACTTAAGGAAATGTTGTGGCTGG + Intronic
921226027 1:213020216-213020238 ATTTAAGGGAATGTTGTAGCTGG - Intergenic
921233455 1:213097942-213097964 GTTTAAGGGAATGTTGGGGCTGG + Intronic
921282036 1:213576987-213577009 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
921298030 1:213722880-213722902 TTTTAAGGGAGTATTCTGGCCGG + Intergenic
921303930 1:213777039-213777061 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
921307932 1:213815659-213815681 CTCTAAGGGAATGTTGTGGCTGG + Intergenic
921308255 1:213818460-213818482 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
921408269 1:214806050-214806072 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
921466115 1:215490447-215490469 GTTTAAGGAAAGGTAGTGGAGGG - Intergenic
921576411 1:216840393-216840415 GCTTAAGGGAATGTTGTGGCTGG + Intronic
921828882 1:219704679-219704701 GCTTAAGGGAATGTTGTGGCTGG - Intronic
921908176 1:220517581-220517603 GCTTAAGAGAATGTTGTGGCTGG - Intergenic
922012623 1:221606577-221606599 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
922032492 1:221815223-221815245 GCTTAAGGAAATGTAGTAGCTGG - Intergenic
922333178 1:224595815-224595837 GCTTAAGGGAATGTGGTGGCTGG - Intronic
922389518 1:225125616-225125638 TCTTAAGGAAATGTTATGGCTGG + Intronic
922495712 1:226056152-226056174 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
922651225 1:227340707-227340729 GCTTAAGGGAATGTAGTGGCTGG + Intergenic
922659030 1:227413126-227413148 GCCTAAGGAAATGTTATGGCTGG + Intergenic
922727932 1:227933365-227933387 GCTTAAGGGAATGCTGTGGCTGG + Intronic
922823379 1:228500390-228500412 GATTAAGGAAATGTTGTGGCTGG + Intergenic
923372005 1:233324073-233324095 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
923481243 1:234386236-234386258 GTTTAAGGGAATATTGTGGCTGG + Intergenic
923763190 1:236866782-236866804 GCTTAAGGGAATATTGTGGCTGG - Intronic
924061487 1:240179518-240179540 GTTCCAGGAAGTGTTGTTCCAGG + Intronic
924354092 1:243151502-243151524 GCTTAAGGGAATGTTGTGGCTGG - Intronic
924409643 1:243790490-243790512 GTTTAGGGAAATGTTGTGGCTGG + Intronic
1062777198 10:161802-161824 GCTTAAGGGAATATTGTGGCTGG + Intronic
1062893883 10:1088151-1088173 GCTAAAGGGAATGTTGTGGCTGG + Intronic
1062897172 10:1112721-1112743 GCTAAAGGGAATGTTGTGGCTGG - Intronic
1063253603 10:4302031-4302053 GTTTAATTAAGAGTTGTGGCCGG + Intergenic
1063329450 10:5142254-5142276 GCCTAAGGGAATGTTGTGGCTGG + Intergenic
1063419786 10:5902723-5902745 ATTTAAGAAAACGTTGTGGCTGG - Intronic
1063824969 10:9886028-9886050 ATTTAAGGAAATGCTGTGGCTGG + Intergenic
1064788348 10:18925244-18925266 GCTTAAGGGAATGTTGTGACTGG + Intergenic
1064949976 10:20837358-20837380 GTTTAAGGGGATGTTGTGTCTGG - Intronic
1065413736 10:25461411-25461433 GCTTAAGGCAGTGTTGTGACTGG - Intronic
1065439547 10:25737004-25737026 GCTTAAGTGAATGTTGTGGCTGG - Intergenic
1065687272 10:28298997-28299019 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1065899589 10:30193643-30193665 GTTTAAGGAAATGTTGTGGCTGG - Intergenic
1066050917 10:31634208-31634230 GCTTAAGGGAATGTTATGGCTGG - Intergenic
1066134924 10:32435736-32435758 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1066374697 10:34847147-34847169 GATTAAGAGAATGTTGTGGCTGG - Intergenic
1067548158 10:47211569-47211591 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
1067728089 10:48788508-48788530 GTTTAAAGATGTGTTGTTACAGG + Exonic
1068269006 10:54695284-54695306 GTTTAAGGGAATGTTGTGGTTGG - Intronic
1068559159 10:58493787-58493809 GGTTAAGAGAATGTTGTGGCTGG - Intergenic
1068940877 10:62679809-62679831 GTTTAAGGAAATGTTGGGGCTGG + Intergenic
1069207492 10:65710079-65710101 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1069292354 10:66795977-66795999 GCTTATGGGAATGTTGTGGCTGG + Intronic
1069938147 10:71933617-71933639 GCTTAAGGGAATGTTATGGCTGG + Intergenic
1069947113 10:71995001-71995023 GCTTAAGGGAATGTTGTGGTTGG + Intronic
1070360855 10:75687408-75687430 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1070489566 10:76964070-76964092 GTTGAAGGATGTGTTAAGGCAGG - Intronic
1071054055 10:81488152-81488174 GCTTAAGGAAATATTGTGCCTGG - Intergenic
1071312452 10:84355804-84355826 TTATAAAAAAGTGTTGTGGCTGG + Intronic
1071364670 10:84886311-84886333 GTTTAAGGAAGCATTGTGTCTGG + Intergenic
1071683459 10:87730737-87730759 GCTTAAGGCAATGTTGTAGCTGG - Intronic
1071763844 10:88639426-88639448 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1071851622 10:89577395-89577417 GCTTAAGGGAATGTTGTGCCTGG + Intergenic
1071854212 10:89606913-89606935 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1071871810 10:89803669-89803691 GTTTAAGGGAGAGTTGTGGATGG + Intergenic
1072059557 10:91796772-91796794 GCTTAAGGAAATCTTGTGGCTGG + Intergenic
1072094766 10:92167139-92167161 GCATAAGGGAATGTTGTGGCTGG + Intronic
1072151120 10:92685014-92685036 GTGTAAGGGAATGTTGTGGCTGG - Intergenic
1072166664 10:92820121-92820143 TTTTAAGGGAATGTTGTGGCTGG + Intergenic
1072601013 10:96929518-96929540 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1072912651 10:99517632-99517654 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
1073598957 10:104828008-104828030 GCTTAAATGAGTGTTGTGGCTGG + Intronic
1073681533 10:105709441-105709463 GCTTAAGGAAATGTTCTGGCTGG - Intergenic
1073781100 10:106839369-106839391 GCTTAAGGAAATGTTGTAGCTGG - Intronic
1074084643 10:110199732-110199754 GCTTAAGGAAATGTTCTGACTGG + Intergenic
1074607237 10:114985321-114985343 GCTTCAGGAAATGTTGTGGCTGG + Intergenic
1074683540 10:115935198-115935220 GTTGCAGGCAGTGTTGTAGCTGG - Intronic
1074691488 10:116009066-116009088 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1074725574 10:116305069-116305091 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
1075010142 10:118861000-118861022 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1075034661 10:119054301-119054323 GCTAAAGGGAATGTTGTGGCTGG + Intronic
1075490763 10:122867114-122867136 GCTTGAGGGAATGTTGTGGCTGG - Intronic
1075847781 10:125559515-125559537 GATTAAGGGAATGTTGTGGCTGG - Intergenic
1075971163 10:126654507-126654529 GCTTAGGGGAATGTTGTGGCTGG + Intronic
1076050235 10:127327524-127327546 GCTTGAGGGAATGTTGTGGCTGG + Intronic
1076128994 10:127998965-127998987 GTTTTAGGAAGTGCTGTAGAAGG + Intronic
1076205952 10:128603117-128603139 GTTTAAGTGAATGTTGTGGTTGG - Intergenic
1077616887 11:3682164-3682186 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1077911485 11:6575521-6575543 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1078193631 11:9115538-9115560 GTTTAAGGGGATGTTGTGGCTGG + Intronic
1078240076 11:9523182-9523204 GTTAAATTACGTGTTGTGGCTGG + Intronic
1078243295 11:9550398-9550420 GCCTAAGGGAATGTTGTGGCCGG - Intergenic
1078398917 11:11006707-11006729 GCTTAAGGGTATGTTGTGGCTGG + Intergenic
1078584270 11:12567575-12567597 GTTTAAGGGAATGTTGTGGTTGG + Intergenic
1078784278 11:14472889-14472911 GCTTAAGGGAATCTTGTGGCTGG + Intronic
1078805226 11:14693081-14693103 GTTTAAGGAAATGTTCTGACTGG - Intronic
1078847867 11:15137709-15137731 GCTTAAGGGAATGTTGTGTCTGG + Intronic
1079158440 11:17970759-17970781 GCTTAAGAGAATGTTGTGGCTGG - Intronic
1079621005 11:22554053-22554075 GTTTAAGGGAATATTGTAGCTGG - Intergenic
1079801103 11:24870072-24870094 GCTTAAGGGAATGTTTTGGCAGG - Intronic
1080064469 11:27994582-27994604 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
1080143737 11:28954083-28954105 GCTTAAGGAACTGTTGTGGCTGG - Intergenic
1080171091 11:29303938-29303960 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1080884816 11:36357136-36357158 GCGTAAGGGAATGTTGTGGCTGG - Intronic
1081186228 11:40046091-40046113 GCTTAAGGGAATGTTGTGGCAGG + Intergenic
1081261577 11:40968175-40968197 GCTTAAGAAAATATTGTGGCTGG - Intronic
1082923047 11:58516616-58516638 CCTTAAGGAAATGTTGTGGCTGG + Intergenic
1083622681 11:64056785-64056807 GCTGAAGGAAGGGTTCTGGCTGG + Intronic
1083976081 11:66121695-66121717 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1084505163 11:69561994-69562016 GCTTAAGGGAATGTTGTGCCTGG + Intergenic
1084662667 11:70555842-70555864 GTTTAAGGGAATGTTGTGACCGG - Intronic
1085500549 11:77018719-77018741 GCTTAAGGCAATGTTGTGGTTGG - Intronic
1085530041 11:77186667-77186689 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1085633249 11:78137298-78137320 GCTTAAGGGAATGTTATGGCTGG + Intronic
1085724859 11:78945811-78945833 GTTTAAGGGAGTGTTGTGGCTGG - Intronic
1086034515 11:82400471-82400493 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1086121621 11:83310620-83310642 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1086281098 11:85190189-85190211 GTTCAAGGAAGTGTTTTGGGAGG - Intronic
1086323539 11:85675036-85675058 GCTTAAAGGAATGTTGTGGCTGG + Intronic
1086494979 11:87393723-87393745 AATTAAGGAAATGATGTGGCTGG - Intergenic
1086646951 11:89234302-89234324 GTTTAAGGAAATGTTGTTGCTGG + Intronic
1086896937 11:92324097-92324119 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1087096895 11:94327805-94327827 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1087316175 11:96605678-96605700 GATTAAGTAACTGTTGTGTCTGG + Intergenic
1087507352 11:99042669-99042691 GTTTAAAGAAGGGAGGTGGCCGG - Intronic
1087577477 11:100007655-100007677 GCTTCAGGGAATGTTGTGGCTGG + Intronic
1087589462 11:100167999-100168021 GTTTAAGGGAATGTTGTGGTTGG - Intronic
1087609423 11:100415740-100415762 GTTTAAGGGAAGGTTGTGGCTGG + Intergenic
1087665638 11:101044390-101044412 GCTTAAGGGAATATTGTGGCTGG + Intronic
1087671240 11:101109493-101109515 GCTGAAGGGAATGTTGTGGCTGG - Intronic
1087775905 11:102256358-102256380 GTTGAGGGAGGAGTTGTGGCAGG + Intergenic
1088462863 11:110101122-110101144 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1088518515 11:110666891-110666913 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1089246620 11:117125666-117125688 GTCTAAGGAAGTTTATTGGCAGG + Intergenic
1090147811 11:124345451-124345473 GCTTAGGGGAGTGTTGTGGCTGG - Intergenic
1090218185 11:124989851-124989873 GCTTAAGGAGCTGTTGTGGCTGG + Intronic
1090266420 11:125356035-125356057 GTTTGAGGAAAAGTTGTGGGGGG - Intronic
1090491394 11:127164102-127164124 GTGTAAGGCAGTGCTGTGGAGGG + Intergenic
1090523159 11:127500512-127500534 GTTTAAGGGAATGTGGTGGCTGG - Intergenic
1092464963 12:8722935-8722957 CCTTAAGGGAATGTTGTGGCTGG + Intronic
1092623544 12:10301005-10301027 GTTTAAGGGAATGTTGTGACTGG + Intergenic
1093002536 12:14013873-14013895 GCTTAAGGAAATATTGTGGCTGG + Intergenic
1093402063 12:18758419-18758441 GCTTAAGGGAGTGTTGTGGCTGG - Intergenic
1093575189 12:20719624-20719646 GCTTAAGGAAATGTTGTGGCTGG - Intronic
1093622789 12:21312362-21312384 GCTCAAGGGAATGTTGTGGCTGG + Intronic
1093823226 12:23647805-23647827 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1094280711 12:28734627-28734649 GCTGAAGGGAATGTTGTGGCTGG - Intergenic
1094440146 12:30466203-30466225 GCTTAAGGAAGTGTTGTGGCTGG + Intergenic
1094664721 12:32507735-32507757 GTTTAAGGAAGTTAAGTGACTGG - Intronic
1095168785 12:39008058-39008080 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
1095208674 12:39467894-39467916 GTTTAAGATAGTGTTATGGCTGG - Intergenic
1095233357 12:39768251-39768273 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1095284730 12:40395342-40395364 GCTTAAGGGAATATTGTGGCTGG + Intronic
1095308429 12:40665063-40665085 GCTTAAGGGAATGTTGTGACTGG - Intergenic
1095311987 12:40709830-40709852 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1095435525 12:42183550-42183572 GTTTAATGAAATGTTGTGACTGG - Intronic
1095466871 12:42496838-42496860 GCTTAGGGGAATGTTGTGGCTGG + Intronic
1095518391 12:43032935-43032957 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
1095605956 12:44068166-44068188 ATTTAGGGGAGTGTTGTGCCTGG + Intronic
1095688093 12:45058557-45058579 GCTTAAGGAAATATTGTAGCTGG + Intergenic
1095719369 12:45384241-45384263 GTCTAAGGGAATATTGTGGCTGG + Intronic
1095729066 12:45485901-45485923 GCTTAAGGAAATGCTGTGGCTGG - Intergenic
1095910583 12:47422624-47422646 GCTTAGGGAAATGTTGTGGCTGG - Intergenic
1096130006 12:49150888-49150910 GCTTAAGAGAATGTTGTGGCTGG - Intergenic
1096432111 12:51554355-51554377 GCTTAAGAAAATGTTGTGGCTGG + Intergenic
1096434989 12:51581982-51582004 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
1097550052 12:61056430-61056452 GCTTAAGGGGATGTTGTGGCTGG - Intergenic
1097788538 12:63788670-63788692 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1097936405 12:65256930-65256952 GTTTAAGGGAATGTTGTGGCAGG + Intergenic
1097954755 12:65472336-65472358 GCTTAAAGAAATGTTGTGGCTGG - Intronic
1098075170 12:66721994-66722016 ATTTAAGGGAATGTTGCGGCTGG + Intronic
1098206625 12:68117623-68117645 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
1098344463 12:69486795-69486817 GCTTAAGGGAATGTTATGGCTGG - Intronic
1098427362 12:70379853-70379875 GCTTAAAGAAATGTTGTGGCTGG + Intronic
1098575770 12:72040403-72040425 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1098785700 12:74751594-74751616 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
1098890018 12:76000548-76000570 GTTTAAGGGACTATTGTGGCTGG + Intergenic
1098921746 12:76308823-76308845 GCTTAAGGGAGTGTTGTGGCAGG + Intergenic
1099052327 12:77795251-77795273 GGTTAAGGGAATGTTATGGCTGG - Intergenic
1099149488 12:79091307-79091329 ATTTTAGGAAGTGGTGTTGCAGG + Intronic
1099609127 12:84843949-84843971 GCTTAAGAGAGTGTTGTGGCTGG - Intergenic
1099789529 12:87314567-87314589 GATTAAGGGAATGTTGTGGCTGG - Intergenic
1099938078 12:89152007-89152029 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
1100117420 12:91324347-91324369 GTCTAAGGGAATGATGTGGCTGG + Intergenic
1100169256 12:91955018-91955040 GTTTAAGGGAATGGTGTGACTGG - Intergenic
1100382725 12:94076658-94076680 TTATAAGGAATTCTTGTGGCTGG + Intergenic
1100818201 12:98406096-98406118 GTTTCCAGAAGTGTTGTGGAAGG + Intergenic
1100940914 12:99721968-99721990 GCTTAAGTAAATGTTGTGGCTGG - Intronic
1101017717 12:100519311-100519333 GATTAAGGGAGGGTTGTGGAGGG + Intronic
1101562181 12:105867493-105867515 GCTTAAGAAAATGTTATGGCTGG - Intergenic
1101677617 12:106932897-106932919 GCTTAAGGAAATGTTGTATCTGG - Intergenic
1101872264 12:108575718-108575740 GCTTACGGAAATGTTGTGGCTGG + Intergenic
1101886982 12:108673279-108673301 GCTTAAGGGAATCTTGTGGCTGG - Intronic
1102371736 12:112387613-112387635 GATTAAGAAAAAGTTGTGGCCGG + Intergenic
1104096429 12:125562275-125562297 GCTGAAGGGAATGTTGTGGCTGG + Intronic
1104144050 12:126015862-126015884 GTTTAAGGGAATGTTGTAGCTGG + Intergenic
1104442317 12:128803913-128803935 GTTTTAGAAAGTGTTCGGGCAGG + Intronic
1104520657 12:129471854-129471876 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1105337692 13:19488687-19488709 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1105753000 13:23439249-23439271 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
1105780091 13:23698123-23698145 GCTTAAGGGACTGCTGTGGCTGG - Intergenic
1106379182 13:29219884-29219906 GCTTAAGGGAATGTTGTGGTTGG + Intronic
1106456548 13:29932788-29932810 GCTAAAGGGAATGTTGTGGCTGG + Intergenic
1106497535 13:30294407-30294429 GCTTAAGGGAATATTGTGGCTGG - Intronic
1106941253 13:34782409-34782431 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1106946688 13:34835658-34835680 GCTTAAGGAAATGTTGTGGCTGG - Intergenic
1107689582 13:42939174-42939196 GCTTAAGGGAATGTTTTGGCTGG + Intronic
1107812191 13:44211265-44211287 GTTTAGGCAAGTGTTATTGCCGG + Intergenic
1108278075 13:48831679-48831701 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1108468002 13:50738063-50738085 GCTTAAGGGAATGTTGTGGATGG - Intronic
1109080535 13:57894166-57894188 GCTTAAGGAAATGTTTTGGCTGG - Intergenic
1109265825 13:60199138-60199160 GTTTAAGAGAGTGTTGTGGGAGG + Intergenic
1109477842 13:62907574-62907596 CTTTAAGGAAATGTTGTAGTAGG + Intergenic
1109533010 13:63677700-63677722 GCTTAAGGGAATGTTTTGGCTGG + Intergenic
1109822142 13:67670735-67670757 GGTTAAGGGAATGTTGTGGTTGG - Intergenic
1109822668 13:67678958-67678980 GGTTAAAGAAGTGTACTGGCAGG + Intergenic
1109927148 13:69158655-69158677 GCTTAAGGGAGGGTTGCGGCTGG - Intergenic
1109953306 13:69531306-69531328 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1109984792 13:69965823-69965845 GCTCAAGGAAGTGTTGTGGCAGG - Intronic
1110300840 13:73924907-73924929 GCTCAAGGGAATGTTGTGGCTGG - Intronic
1110316387 13:74113024-74113046 GTTTAAGGGAATGTTGTGGCTGG - Intronic
1110368493 13:74714818-74714840 GCTTAAGGGAGTGTTGTGGCTGG + Intergenic
1110521611 13:76485781-76485803 ATTTAAGGGAATGTTGTGGCTGG - Intergenic
1110737575 13:78955450-78955472 ACTTAAGAAAATGTTGTGGCTGG + Intergenic
1110746325 13:79057552-79057574 GTTTAAGGGAATGTTGTAGCTGG - Intergenic
1110934336 13:81266361-81266383 GCTTAAGGAAATATTGTGGCTGG + Intergenic
1111146293 13:84185163-84185185 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1111163583 13:84427677-84427699 GCGTAAGGGAATGTTGTGGCTGG - Intergenic
1111193285 13:84837556-84837578 ATTTAAAGAAGTTTTATGGCCGG + Intergenic
1111220187 13:85194791-85194813 GCTTAAGGGAATATTGTGGCTGG - Intergenic
1111324207 13:86670374-86670396 GTTTAAGGGAGTGTTATAACTGG + Intergenic
1111467380 13:88632666-88632688 GCTTAAGGGAATGGTGTGGCTGG - Intergenic
1111617611 13:90681005-90681027 GTTTAAAGGAATGTTGTGGCTGG + Intergenic
1111860786 13:93702864-93702886 GCTGAAGGAAATGCTGTGGCTGG + Intronic
1112116156 13:96357135-96357157 TCTTAAGGGAATGTTGTGGCTGG + Intronic
1112184364 13:97113905-97113927 TTTTTAGGAAGTGCTGTGCCAGG - Intergenic
1112208787 13:97352090-97352112 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1112521176 13:100096764-100096786 GCTTAAGGAAATGTTGTGGCTGG - Intronic
1112555928 13:100468689-100468711 GCTTAAGTGAATGTTGTGGCTGG + Intronic
1112856680 13:103779344-103779366 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1113137532 13:107109827-107109849 GCTTCAGGGAGTGTTGTGGTTGG + Intergenic
1113170182 13:107492343-107492365 GTTTAAGACAGGCTTGTGGCTGG - Intronic
1113554996 13:111226137-111226159 CCTTAAGGAAATGTTGTGGCTGG - Intronic
1114585481 14:23809107-23809129 GCTTAAGAGAATGTTGTGGCTGG - Intergenic
1114592004 14:23874423-23874445 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1114717769 14:24845653-24845675 GTTTAAGAAAATGGTGTGGTAGG + Intronic
1114976943 14:28113577-28113599 GTTTAATGTAGTATTCTGGCTGG + Intergenic
1115136334 14:30113116-30113138 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1115154701 14:30324774-30324796 GCTTAAGGGAATGTTGTAGCTGG - Intergenic
1115258800 14:31431572-31431594 GATTAAGGGAATGTTGTGGCTGG - Intronic
1115280477 14:31656218-31656240 GGTTAAGAGAATGTTGTGGCTGG + Intronic
1115308265 14:31954170-31954192 GGTTAAGAGAATGTTGTGGCTGG - Intergenic
1115379127 14:32713749-32713771 GCTTGAGGGAATGTTGTGGCTGG + Intronic
1115419065 14:33171609-33171631 GCTTACGGGAATGTTGTGGCTGG + Intronic
1115498353 14:34027633-34027655 GCTTAAGGGAATGTTGTGACTGG + Intronic
1115542148 14:34431005-34431027 GCTTAAGGGAATATTGTGGCTGG - Intronic
1115621979 14:35149651-35149673 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1115627875 14:35213150-35213172 GTGTAAGGGCATGTTGTGGCTGG + Intronic
1116091694 14:40315919-40315941 TTTTAAGGGAATGTTGTGGCTGG - Intergenic
1116141701 14:41004345-41004367 GTTTAAGGGATTGTTGTCGCTGG - Intergenic
1116277302 14:42851948-42851970 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
1116476167 14:45342274-45342296 GCTTAAGGAAATCTTGTGGCTGG + Intergenic
1116607151 14:47014723-47014745 GTTTAATGCAATGTTGTGGCAGG + Intronic
1117296361 14:54383278-54383300 GCTTAAGGGAATATTGTGGCTGG - Intergenic
1117764460 14:59066460-59066482 GCTTAAGGGAATGATGTGGCTGG + Intergenic
1117858293 14:60059627-60059649 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1117926755 14:60788833-60788855 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1118507744 14:66432781-66432803 GGTTAAGGGAATGTTGTAGCTGG - Intergenic
1118656096 14:67950490-67950512 CCTTAAGGTAATGTTGTGGCTGG + Intronic
1118662586 14:68030582-68030604 GTTTAAGGTAGTGTTGTGGCTGG + Intronic
1118677539 14:68203942-68203964 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1118959939 14:70519977-70519999 AATTAAGGGAATGTTGTGGCTGG - Intergenic
1119005093 14:70918093-70918115 AATTAAGGGAATGTTGTGGCTGG + Intronic
1119883337 14:78119579-78119601 GCTGAAGGAAATGTTGTGGCTGG + Intergenic
1119964216 14:78895464-78895486 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1120323774 14:82999622-82999644 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1120482070 14:85062765-85062787 GTTTAAGGGAATATTGTAGCTGG - Intergenic
1120755298 14:88238242-88238264 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1121018657 14:90565160-90565182 GCTTAAGGGAATATTGTGGCTGG + Intronic
1121296278 14:92827854-92827876 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1121766570 14:96492421-96492443 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1121998025 14:98620749-98620771 GCTTAAGGAAATGTTATGGCTGG - Intergenic
1122428649 14:101626148-101626170 GTTTGTGGATGGGTTGTGGCTGG + Intergenic
1122431807 14:101655364-101655386 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
1123128798 14:105969202-105969224 GTTCAAGGAAATGTGGGGGCAGG + Intergenic
1124397188 15:29313057-29313079 GCTTAAGGGAATGTTGTGTCTGG - Intronic
1124461051 15:29892174-29892196 ATTTAAGGGAATGTTGTGGCTGG - Intronic
1125099553 15:35895320-35895342 GCTTAAGGGAATGTTGTGGTGGG + Intergenic
1125793280 15:42386073-42386095 GTTCAGGGAAGTGGAGTGGCTGG + Intronic
1125803133 15:42468372-42468394 TTTAAAAGAAGTGTTTTGGCTGG - Intronic
1126027104 15:44457476-44457498 GTTTAAGGGAATGCTGTGGCTGG + Intronic
1126307407 15:47276014-47276036 GTTCAAGGGAATGCTGTGGCTGG - Intronic
1126828288 15:52572833-52572855 GCTTAAAGGAGTGTTGTGGCTGG - Intergenic
1127081396 15:55383834-55383856 GCTTAAGGGAATTTTGTGGCTGG + Intronic
1127206191 15:56721725-56721747 GCTTAAGGGAATGTTGTGGCGGG + Intronic
1127509961 15:59630764-59630786 ATTTAAGGGAATGTTGTGGCTGG + Intronic
1127509968 15:59630802-59630824 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1127573376 15:60265897-60265919 GTTTAAGAATGGGTGGTGGCCGG + Intergenic
1127724852 15:61739471-61739493 GCTTAAGGAAATGTTGGGGCTGG + Intergenic
1127757449 15:62106469-62106491 GAATAAGGGAATGTTGTGGCTGG - Intergenic
1127948623 15:63781914-63781936 GTTTAAGGGAATATTGTGACTGG - Intronic
1128427135 15:67553615-67553637 GTTTAAGAAATAGTTGAGGCCGG + Intronic
1128484901 15:68075380-68075402 GTTTAAGAAAATGTTTTGGCTGG - Intronic
1129126408 15:73445333-73445355 GCTTAAGGGAATGTTGTGACTGG + Intronic
1129575391 15:76737939-76737961 GCTTAACGGAATGTTGTGGCTGG + Intronic
1130617402 15:85424513-85424535 GTTTAAGGGAACGTTGTGGCTGG + Intronic
1131042786 15:89287422-89287444 ACTTAAGGGAATGTTGTGGCTGG + Intronic
1131572425 15:93552720-93552742 GATTAAGGACTTGTTGGGGCTGG + Intergenic
1132475311 16:133123-133145 GTTTAAGAGAATATTGTGGCTGG + Intronic
1133073420 16:3262013-3262035 GTTTGAGGAAGAGTGGTGGCTGG + Intergenic
1133093003 16:3419522-3419544 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1133512909 16:6478034-6478056 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1134272951 16:12750086-12750108 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1135506601 16:23042831-23042853 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1135705435 16:24670906-24670928 ATGTAAGGAAGTGTGGGGGCTGG - Intergenic
1135766446 16:25181466-25181488 GCTTAAGGGAAGGTTGTGGCTGG - Intergenic
1135946795 16:26872262-26872284 GTTTAAGGAACAGTTGTGTTTGG - Intergenic
1136025632 16:27466825-27466847 GCTTAAGGGAAGGTTGTGGCTGG - Intronic
1136611229 16:31367053-31367075 GCTTAAGGGGATGTTGTGGCTGG - Intronic
1136871488 16:33811671-33811693 GTTCAAGGAATTGTGGGGGCAGG - Intergenic
1139014041 16:62668462-62668484 GCTTAAGGAAATGGTGTGACTGG - Intergenic
1140162596 16:72513439-72513461 GCTTAAGGGAATGTTGTGACTGG + Intergenic
1140287908 16:73622069-73622091 GTTGAAGGAAGTTTTGGGTCAGG - Intergenic
1140398999 16:74654841-74654863 ACTTAAGGGAATGTTGTGGCTGG - Intronic
1140549079 16:75844436-75844458 GCTTAAAGAATTGCTGTGGCTGG + Intergenic
1140872273 16:79117887-79117909 GCTTCAGGGAATGTTGTGGCTGG + Intronic
1141292277 16:82730044-82730066 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1141777068 16:86131102-86131124 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1203100684 16_KI270728v1_random:1304387-1304409 GTTCAAGGAATTGTGGGGGCAGG + Intergenic
1143442886 17:6989168-6989190 GTTTAAGGGAATGTTGTGGATGG - Intronic
1144265700 17:13566705-13566727 GCTTAAGGGGATGTTGTGGCTGG - Intronic
1144530767 17:16036766-16036788 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1146218108 17:30995090-30995112 ATTTAAAGAATTGTTTTGGCCGG + Intronic
1146412642 17:32600701-32600723 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1146838213 17:36129521-36129543 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1147118844 17:38323248-38323270 GTATCAGGAAGTGTTGGGGGAGG + Intergenic
1148255065 17:46123618-46123640 GTTTAATGGAATGTTGTGGCTGG - Intronic
1149177093 17:53885847-53885869 GCTTAAGGGAAGGTTGTGGCTGG + Intergenic
1149299442 17:55290953-55290975 GCTTAAGGGAATGTTGTGGATGG - Intronic
1149518423 17:57299169-57299191 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1150014330 17:61538486-61538508 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1150662608 17:67096727-67096749 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1150833918 17:68547696-68547718 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1151377649 17:73701940-73701962 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1151410841 17:73927462-73927484 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1151579373 17:74969497-74969519 TTTGAAGGAAGTGTTTTTGCTGG + Intronic
1152434524 17:80267545-80267567 GTTTAAGGGAATGTTGTGACTGG - Intronic
1152902520 17:82951457-82951479 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1152932023 17:83114851-83114873 GTTTAAGCAAGTGCTGTCTCTGG + Intergenic
1153120211 18:1715125-1715147 GTTTAAGAAAGTGTTTTCTCTGG - Intergenic
1153133148 18:1881040-1881062 GCTTAAGGGAATGTTATGGCTGG + Intergenic
1153181504 18:2440305-2440327 GATTAAGGAAATGTTATGGCTGG + Intergenic
1153292770 18:3517869-3517891 GCTTAAGGGAATGTTGTGCCTGG + Intronic
1153352906 18:4100932-4100954 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1153395363 18:4614113-4614135 GTTTAAGGGAATGCTGTGGCTGG + Intergenic
1153566388 18:6422371-6422393 GCTAAAGGGAATGTTGTGGCTGG + Intergenic
1153859698 18:9189196-9189218 GTTTAAGGGGATGTTGTAGCTGG - Intronic
1154227680 18:12522277-12522299 GTTTAAGGGAATGTTGTGGCTGG - Intronic
1154341680 18:13508113-13508135 TCTTAAGGGAATGTTGTGGCTGG - Intronic
1154370606 18:13758599-13758621 GATAAAGGGAATGTTGTGGCTGG + Intronic
1155266091 18:24095276-24095298 GTTTAAAGGAATGTTGTGGCTGG + Intronic
1155480691 18:26284280-26284302 GCTTAAGGGAATGTTGTAGCTGG + Intronic
1155511923 18:26586757-26586779 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1155824660 18:30424634-30424656 GTTTAAGGGAATATTGTGGCTGG - Intergenic
1155827403 18:30465064-30465086 GCTTAAAGGAATGTTGTGGCTGG + Intergenic
1155853726 18:30805615-30805637 GCTTAAGGGAATGTTGTGTCTGG - Intergenic
1156085828 18:33400660-33400682 GTTTAAGGGAATGTTGTGTCTGG + Intronic
1156130994 18:33974315-33974337 GCTTAAGGGAATATTGTGGCTGG + Intronic
1156168436 18:34452662-34452684 GATTAAGAGAATGTTGTGGCTGG + Intergenic
1156629207 18:38946383-38946405 GTTTAAAGAAAGATTGTGGCTGG - Intergenic
1156785565 18:40909774-40909796 GTTTAAGGAAATGTCTTGGCTGG + Intergenic
1157171195 18:45407396-45407418 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1158204597 18:54978504-54978526 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
1158446253 18:57524581-57524603 GTTTAAGGGAATGCTGTGGCTGG - Intergenic
1158757348 18:60341981-60342003 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
1158816637 18:61105663-61105685 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1158919211 18:62170917-62170939 GCTTGAGGAAATGTTGTGGCTGG - Intronic
1159198879 18:65157172-65157194 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1159332091 18:67009019-67009041 GTTTGAGGAAATATTGTAGCTGG + Intergenic
1159388852 18:67761818-67761840 GTTTAAGGGAATGCTGTTGCTGG - Intergenic
1159514470 18:69439734-69439756 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1159656885 18:71040640-71040662 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1160097112 18:75884420-75884442 GCTTAAGGGAATGTTGTGACTGG + Intergenic
1160166129 18:76514019-76514041 GCTTAAGGGAATGTTCTGGCTGG + Intergenic
1160320544 18:77889382-77889404 GCTTGAGGGAATGTTGTGGCTGG + Intergenic
1160520250 18:79504028-79504050 GCTTAAGGGAGTGTTGTGGCTGG + Intronic
1160552097 18:79700461-79700483 GCTTAAGGGAATGTTGTGACTGG - Intronic
1161788171 19:6341196-6341218 GTTCAAGCAATTCTTGTGGCAGG + Intergenic
1162264830 19:9563245-9563267 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1162843831 19:13375972-13375994 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1164901173 19:31925634-31925656 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
1164933511 19:32193822-32193844 GTTTTAGGCAGGGTAGTGGCCGG + Intergenic
1164940178 19:32246338-32246360 GCTTAAGGGAATGTTGTGGTTGG - Intergenic
1165644357 19:37421620-37421642 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1166580151 19:43889860-43889882 GCTTAAGGGAATTTTGTGGCTGG + Intronic
1167021754 19:46882075-46882097 GTTTAAGGGAATATTGTGGCTGG + Intergenic
1167164163 19:47786918-47786940 GTTTAAGCAAGAATTCTGGCAGG + Intergenic
1167306427 19:48712726-48712748 TATTAAAGAAGTGTTCTGGCTGG - Exonic
1168156579 19:54476598-54476620 ATTAAAAGAAGTGTGGTGGCCGG - Intergenic
924989691 2:302041-302063 GCTGAAGGGAGTGTTGTGGCTGG - Intergenic
925104203 2:1275958-1275980 GCTTAAAGGAGTATTGTGGCTGG - Intronic
925507938 2:4589991-4590013 GCTTAAGAAAATGGTGTGGCTGG - Intergenic
926031960 2:9599110-9599132 ATTTAAAGGAATGTTGTGGCTGG - Intronic
926233978 2:11025678-11025700 GCAGCAGGAAGTGTTGTGGCGGG - Intergenic
926387944 2:12356280-12356302 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
926543495 2:14209812-14209834 GTTTAAGAATAAGTTGTGGCCGG + Intergenic
926649426 2:15325629-15325651 GCTTAAGGGAATGTTGTGGCTGG + Intronic
926722243 2:15969515-15969537 ATTTAAGGGAATGTTGTGGCTGG + Intergenic
926979170 2:18548946-18548968 GCTTTAGGGAATGTTGTGGCTGG - Intergenic
927014359 2:18942085-18942107 GTTTAAAAGAATGTTGTGGCTGG + Intergenic
927322519 2:21763852-21763874 GCTTAAGGAAATCTTGGGGCTGG + Intergenic
927324596 2:21789577-21789599 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
927396424 2:22656310-22656332 GATTAAGGGAATGTTGTGGCTGG - Intergenic
927477676 2:23426284-23426306 ATTTGAGGATGGGTTGTGGCAGG - Intronic
928046166 2:27934771-27934793 GCTTAAGGGAATCTTGTGGCTGG - Intronic
928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG + Intergenic
928716100 2:34062732-34062754 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
928720101 2:34110638-34110660 GCTTAAGTGAATGTTGTGGCTGG - Intergenic
928726606 2:34181070-34181092 GCTGAAGGGAATGTTGTGGCTGG - Intergenic
928792038 2:34969051-34969073 GTTCAAGGAAATGCTGTTGCTGG + Intergenic
929097463 2:38277501-38277523 GCTTAAGAAAATGTTGTGACTGG + Intergenic
929323227 2:40572199-40572221 CTTTAAGGGAATGTTGTGGCTGG - Intronic
929338134 2:40777345-40777367 GCTTAAGGGAATGTTGTGACTGG + Intergenic
929473495 2:42220875-42220897 GCTTAAGGGAATGTTGTGTCTGG - Intronic
929529731 2:42741251-42741273 GGTTAAGGGAATGTTGTTGCTGG + Intronic
929672881 2:43891995-43892017 TTTTAAGGGAATGTTGTGGCTGG - Intronic
929757801 2:44782089-44782111 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
929842215 2:45479496-45479518 GCTTAAGGGAATGTTGTGGCTGG - Intronic
929866824 2:45724724-45724746 GCTTAAGGGAATGTTGTGGCTGG - Intronic
930052919 2:47230294-47230316 GATTAACCAAGTGTGGTGGCAGG + Intergenic
930127895 2:47817306-47817328 GCTTAAGGGAATGTTGCGGCTGG + Intronic
930195747 2:48508059-48508081 TTTAAAGGCAGAGTTGTGGCTGG - Intronic
930315167 2:49788444-49788466 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
930362098 2:50394240-50394262 TTTTCAGGGAGAGTTGTGGCTGG - Intronic
930492004 2:52085855-52085877 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
930504928 2:52271484-52271506 GTTTACAGAAATGTTGTGGCTGG + Intergenic
930583173 2:53237036-53237058 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
930759976 2:55023191-55023213 ATTCAAGGATGTGTTTTGGCAGG - Intronic
930800227 2:55436162-55436184 AGTTAAGGGAATGTTGTGGCTGG + Intergenic
931022369 2:58062624-58062646 GCTTAAGGGAATGTTGTGGCTGG - Intronic
931683872 2:64776123-64776145 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
931895293 2:66722105-66722127 GCTTAAGGGAGTGTCGTGGTTGG - Intergenic
932033321 2:68213038-68213060 GCTTAAGGGAATTTTGTGGCTGG + Intronic
932689870 2:73903092-73903114 GTTTAAGAAAATATTGTGGGGGG + Intronic
932874907 2:75441542-75441564 GTTTAAGGAAGTCTGGTGTTGGG + Intergenic
933063781 2:77769567-77769589 CTTTAAGAAAGTAATGTGGCTGG + Intergenic
933082876 2:78015361-78015383 GCTTGAGGGACTGTTGTGGCCGG + Intergenic
933414242 2:81965634-81965656 GCTTAAGGCAGTGCTGTGGCTGG - Intergenic
933630145 2:84646646-84646668 GCTTAATGGAATGTTGTGGCTGG - Intronic
934059017 2:88276824-88276846 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
934061678 2:88300182-88300204 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
934127352 2:88909743-88909765 GATTAAGGGAATGTTGTGGCTGG - Intergenic
935036684 2:99383493-99383515 GCTTAAGGGAGTGTTGTGGCTGG - Intronic
935176115 2:100650112-100650134 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
935289077 2:101593946-101593968 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
935295180 2:101643265-101643287 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
935772974 2:106444797-106444819 GTTTTGGGAGGTGCTGTGGCTGG - Intronic
935907094 2:107851134-107851156 GTTTTGGGAGGTGCTGTGGCTGG + Intronic
935974315 2:108562522-108562544 ACTTAAGGGAATGTTGTGGCTGG - Intronic
936798184 2:116232613-116232635 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
937110037 2:119358657-119358679 GCTTAAGGAAATGTTGTGGGTGG - Intronic
937174062 2:119908927-119908949 GCTTAAGGGAATGCTGTGGCTGG - Intronic
937767061 2:125673864-125673886 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
937830314 2:126413270-126413292 GTTTAAAGCAATGTTGTGGTTGG + Intergenic
937979248 2:127604394-127604416 GCTTAAGGAAATGTTGTGGCTGG + Intronic
938022442 2:127917170-127917192 GCTTAAGGGAATGTTGTGGCAGG + Intergenic
938174142 2:129108821-129108843 GCTTAACGGAATGTTGTGGCTGG + Intergenic
938562517 2:132486721-132486743 GGTTAAGGGAATGTAGTGGCTGG + Intronic
938606549 2:132899329-132899351 GCTTAAGGGAATGTCGTGGCTGG + Intronic
938678613 2:133665049-133665071 GCTTAAGGAAATGTTATGGCTGG + Intergenic
938946947 2:136221319-136221341 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
938960653 2:136337763-136337785 GCTTAAGAGAATGTTGTGGCTGG - Intergenic
939308933 2:140447538-140447560 GCTTAAGGAACTGTTGTGGATGG + Intronic
939324000 2:140663620-140663642 GTTTATGGGAATGTCGTGGCTGG + Intronic
939663695 2:144922851-144922873 GCTTAAGTGAATGTTGTGGCTGG - Intergenic
939722700 2:145674794-145674816 GTTTAAGGGAATGTTGTAGCTGG + Intergenic
939973339 2:148687288-148687310 GCTTACGGGAATGTTGTGGCTGG + Intronic
940049345 2:149445721-149445743 GTTTAAGGGAATGCTGTGGCTGG + Intronic
940399885 2:153236071-153236093 GCTTAAGGGAATTTTGTGGCTGG - Intergenic
941503729 2:166313602-166313624 GCTTAAGGAAATGTTGTGGCTGG + Intronic
941733048 2:168940419-168940441 GCTTAAGGCAATGTTGTAGCAGG - Intronic
942050895 2:172139865-172139887 GCTTAAGGGAAGGTTGTGGCTGG - Intergenic
942177853 2:173352009-173352031 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
942238057 2:173931877-173931899 GTTTAAAGGAATGTTGTGGCTGG + Intronic
942281559 2:174369351-174369373 GCTTAAGGGAATGTTGTGGATGG + Intronic
942534227 2:176946333-176946355 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
942747818 2:179255461-179255483 GCTTAAGGGAATGTTATGGCTGG - Intronic
943083940 2:183289593-183289615 GTTTAGGGGAATGTTGTGGCTGG - Intergenic
943213360 2:184998479-184998501 GCTTAAGGAAATATTGTGGCTGG + Intergenic
943246971 2:185467024-185467046 GCTTAAGGGAGTGTTGTGGCTGG + Intergenic
943604841 2:189964800-189964822 GCATAAGGGAATGTTGTGGCTGG + Intronic
943616530 2:190099011-190099033 GCTTAAAGGAATGTTGTGGCTGG + Intronic
943905717 2:193499406-193499428 ACTTAAGGAAATGTTTTGGCTGG - Intergenic
943935476 2:193910005-193910027 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
944100755 2:196023597-196023619 GCTTAAGGAAATGTCATGGCTGG + Intronic
944273980 2:197814823-197814845 GCTTAAGGAAATGTTATGGCTGG - Intronic
944338520 2:198566688-198566710 GCTTAAGGGAATGTTGTGGCTGG - Intronic
944750101 2:202700421-202700443 GCTTAATGAAATGTTGTGGCTGG - Intronic
945346082 2:208718373-208718395 GCTTAAGGGAATGTTGCGGCTGG + Intronic
945442837 2:209900866-209900888 GTTTAAGAGAATATTGTGGCTGG - Intronic
945505057 2:210629609-210629631 ATATAAGAAAGTGTTCTGGCTGG - Intronic
945541734 2:211096251-211096273 GCTTACGTAAATGTTGTGGCTGG - Intergenic
945690897 2:213034185-213034207 ATTTAAGAGAATGTTGTGGCTGG + Intronic
946086294 2:217176517-217176539 GCTTAAGGGGGTGTTGTGGCTGG + Intergenic
946091618 2:217230093-217230115 ACTTAATGAAGTGCTGTGGCTGG + Intergenic
946460441 2:219863911-219863933 CTTTGAGGATGTGGTGTGGCCGG + Intergenic
946713565 2:222530631-222530653 GCTTAAGGGAATGTTGTGACTGG + Intronic
946853157 2:223927562-223927584 GCTTAAGAGAATGTTGTGGCTGG + Intronic
946901315 2:224374696-224374718 TCTTAAGGCAATGTTGTGGCTGG - Intergenic
947045257 2:225975158-225975180 CCTTAAGGAAATGTTGTGTCTGG + Intergenic
947050395 2:226036284-226036306 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
947458139 2:230275887-230275909 GCTTAAGGGAATGTTGTGGCTGG - Intronic
947654629 2:231816166-231816188 GCTTAAGGGAGTGTTGTGGCTGG + Intergenic
947754147 2:232549580-232549602 GCTTAAGGGAATGTTGCGGCTGG + Exonic
947786339 2:232824467-232824489 GCTTAAGGGAATGTTGCGGCTGG - Intronic
948043651 2:234926007-234926029 GTTTAAGAAAATACTGTGGCTGG - Intergenic
948107175 2:235423979-235424001 GCTTAAGGAAATGTTATGGCTGG - Intergenic
948506520 2:238431388-238431410 GCCTAAGGGAATGTTGTGGCTGG + Intronic
1169048996 20:2560457-2560479 GACTAAGGAAGGGTTATGGCTGG - Intronic
1169360815 20:4947253-4947275 GTTCAGGGAAATCTTGTGGCTGG + Intronic
1169432731 20:5553702-5553724 GCTTAAGGAAATGTTTTGGCTGG - Intronic
1169518439 20:6344345-6344367 GCTTAAGGGAATTTTGTGGCTGG + Intergenic
1169535153 20:6530917-6530939 GCTTAAGGAAATGTTGTAGCTGG + Intergenic
1169616291 20:7449747-7449769 GCTTAAGGGAATGTTGGGGCTGG - Intergenic
1169653916 20:7901007-7901029 GTTTAAGGGAGAATGGTGGCTGG - Intronic
1169864752 20:10187990-10188012 GTATGAGGAAGTGTTGTGTGAGG - Intergenic
1170247038 20:14232663-14232685 GTTTAAGGGAATATTGTGGTTGG + Intronic
1170286999 20:14720846-14720868 GTTAAAAGAAGTTTTGTGGGCGG - Intronic
1170397162 20:15938940-15938962 GCTTAAGGGAATGTTATGGCTGG - Intronic
1170904530 20:20501533-20501555 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1171313211 20:24162857-24162879 GCTTAGGGGAATGTTGTGGCTGG - Intergenic
1171323780 20:24272224-24272246 GCTTAAGGAAAAGTTGTGGCTGG + Intergenic
1172660928 20:36568203-36568225 GTTTAAGGGAACGTTGTCGCTGG + Intergenic
1172922839 20:38500864-38500886 GCTTAAGAAAATGTTGTGACTGG - Intronic
1173107069 20:40147510-40147532 GCTTAAGGAAAGGTTGTAGCTGG + Intergenic
1173766776 20:45618256-45618278 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1174745914 20:53062636-53062658 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1175025548 20:55898646-55898668 GCTTAAGGGAATGATGTGGCTGG + Intergenic
1175250415 20:57606239-57606261 GTTTAAGAGATTGTTGTAGCTGG - Intronic
1175649729 20:60709157-60709179 GCTTAGGGGAATGTTGTGGCAGG - Intergenic
1176311294 21:5151724-5151746 GCTTAAAGGAATGTTGTGGCTGG + Intronic
1176726197 21:10435350-10435372 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1176735875 21:10546704-10546726 GCTTAAGGGAATGCTGTGGCCGG - Intronic
1177087488 21:16725069-16725091 ATTTGAAGAAATGTTGTGGCTGG + Intergenic
1177167594 21:17619971-17619993 GCATAAGGGAATGTTGTGGCTGG + Intergenic
1177286324 21:19056124-19056146 GTTTATGGGAATGTTGTGGCTGG - Intergenic
1177335684 21:19723050-19723072 GCTTAAGTAAGTGTTGTGGTTGG + Intergenic
1177404540 21:20647779-20647801 GATTATGGAAATGATGTGGCTGG - Intergenic
1177461425 21:21415845-21415867 GCTTAAGGGAGTATTGTGGTTGG + Intronic
1177526990 21:22306088-22306110 GCTAAAGGGAATGTTGTGGCAGG + Intergenic
1177869249 21:26550620-26550642 GCTTAAGGGCATGTTGTGGCTGG - Intronic
1177912124 21:27045821-27045843 GTGTCAGGAAGTGATGTGGAAGG + Intergenic
1178195932 21:30345169-30345191 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1178519408 21:33275539-33275561 GCTTAAGGGAATGGTGTGGCTGG + Intronic
1178967553 21:37136487-37136509 GCTTAAGAGAATGTTGTGGCTGG - Intronic
1179148685 21:38792149-38792171 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1179402398 21:41096200-41096222 GTATAAGGAGGTGGTGTGGAAGG + Intergenic
1179675406 21:42977930-42977952 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1179814188 21:43893358-43893380 GTTTAAGGGAATATTGAGGCTGG + Intronic
1179845756 21:44110311-44110333 GCTTAAAGGAATGTTGTGGCTGG - Intronic
1180288174 22:10771761-10771783 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1180848836 22:19000422-19000444 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1180900112 22:19365023-19365045 GATTAAGGGAGTGTTGTGGCTGG - Intronic
1181664031 22:24378324-24378346 GCTTAAGGGAATGTTGTAGCTGG + Intronic
1181930601 22:26397960-26397982 GCTTAAGGAGATGTGGTGGCTGG + Intergenic
1182182151 22:28361402-28361424 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1183048753 22:35243639-35243661 GTTTAAGCAATTCTTGTGGCTGG + Intergenic
1183234053 22:36603198-36603220 GCTTAAGGGAATGTTGTGTCTGG - Intronic
1183268023 22:36842115-36842137 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1183283398 22:36946535-36946557 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1183533276 22:38376165-38376187 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1183681455 22:39332527-39332549 GTTTAAGAGAATGTTGTGGCTGG + Intergenic
1183757912 22:39787611-39787633 GCTTAAGGGAATGTTGGGGCTGG - Intronic
1184082973 22:42238342-42238364 GCTTAAGGGAATGTTGCGGCTGG + Intronic
1184725104 22:46340001-46340023 GTCTCAGGAAGTGCTGTTGCTGG + Intronic
1185096974 22:48814363-48814385 GCTTAAGGGAATGTTGTGGCTGG - Intronic
949626449 3:5872167-5872189 GCTTAAGGGAATATTGTGGCTGG - Intergenic
949649868 3:6144635-6144657 GTTGAAAGAAGTGATGTGACTGG - Intergenic
949728723 3:7081830-7081852 GCTTAAGGGAGTGTTGTGGCTGG - Intronic
949744790 3:7276997-7277019 GTTAAAAGCAGTGTTGTAGCTGG + Intronic
949809827 3:7994735-7994757 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
950112694 3:10429913-10429935 GCTTAAGGGAATGTTGTGGCTGG - Intronic
950314984 3:11993918-11993940 GCTTAAGGAAATGTTGTTACTGG + Intergenic
950404225 3:12794630-12794652 GTTTAAGAAAATGCTGTGGCTGG - Intergenic
950562144 3:13737757-13737779 GCTTAAGGAAGTGTTGTGGCTGG - Intergenic
950988892 3:17409712-17409734 GCTTAAGGGAATGTTGTGGCTGG - Intronic
951307193 3:21079350-21079372 GCCTAAGGGAATGTTGTGGCCGG + Intergenic
951346645 3:21554907-21554929 ATTTAAGGAAATGGTATGGCTGG + Intronic
951517472 3:23577398-23577420 GCTTAAGGGAGTGTTGTAGCTGG - Intronic
951530045 3:23690159-23690181 GTTTAAACGAATGTTGTGGCTGG + Intergenic
951608809 3:24468226-24468248 GCTTAAGGGAATGTTGCGGCTGG + Intronic
951851819 3:27150008-27150030 GCTTAAGGGAATGTTGTGGCAGG - Intronic
952015684 3:28954191-28954213 GCATAAGGGAATGTTGTGGCCGG - Intergenic
952119408 3:30223986-30224008 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
952390922 3:32879200-32879222 GCTTAAGGAGATGTTATGGCTGG + Intronic
952639285 3:35572838-35572860 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
952809994 3:37393458-37393480 GTTTAAGGGAATGTTATGGCTGG - Intronic
953121701 3:40049890-40049912 GCTTAAGGGAATGTTGTGGCAGG - Intronic
953367252 3:42355762-42355784 GCTTAAAGAAATATTGTGGCTGG - Intergenic
953591959 3:44266217-44266239 GCTTAAGGGAATGTTGTGACTGG + Intronic
953646427 3:44760180-44760202 GTTAAAGGGAATGTTGTGGCTGG + Intronic
953837986 3:46363863-46363885 ACTTAAGGAAATGTTGTGGCTGG - Intergenic
954373126 3:50179895-50179917 GCTTAAAGGAATGTTGTGGCTGG + Intronic
954944629 3:54409731-54409753 GCTTAAGGAAGTATTGTGACAGG - Intronic
955164493 3:56497547-56497569 GTTTAAGGAAATGTTGTGGCTGG + Intergenic
955354470 3:58219348-58219370 GCTTAAAGGAATGTTGTGGCTGG - Intergenic
955382223 3:58448632-58448654 GCTTAAGGGAATATTGTGGCTGG + Intergenic
955414522 3:58680087-58680109 GTTTAAGGAAGTGTCTGGGTGGG + Intergenic
955426607 3:58797375-58797397 GCTTAAGGGAATGTTGTGGCTGG - Intronic
955519258 3:59759151-59759173 CTTCAAGGAAGTGTGGTGGTTGG + Intronic
955678268 3:61472284-61472306 GCTTAGGGGAGTGTTGTGACTGG + Intergenic
955830989 3:63003760-63003782 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
956063518 3:65372907-65372929 GCATAAGGGAATGTTGTGGCTGG + Intronic
956098176 3:65739346-65739368 GCTTAAGGAAATGTTGTACCTGG + Intronic
956163091 3:66375118-66375140 GCTTAAGGGGATGTTGTGGCCGG - Intronic
956180460 3:66513325-66513347 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
956409250 3:68962009-68962031 GTTTAAGGGAGTGTTGTGGAGGG + Intergenic
956887427 3:73574381-73574403 TTTTAAAGAAGTGTTGTGAGGGG - Intronic
957179299 3:76856543-76856565 ATTTAAGAAAGTGTAGGGGCAGG - Intronic
957269036 3:78004675-78004697 GCTTAAGAGAATGTTGTGGCTGG + Intergenic
957282563 3:78172444-78172466 CTTTCAGGAAGTTTTGAGGCAGG - Intergenic
957499701 3:81038505-81038527 GCTTAAGGGAATGTTGTGACTGG + Intergenic
957645337 3:82914876-82914898 GCTTAAGCGAATGTTGTGGCTGG - Intergenic
957996749 3:87699619-87699641 GCTTAAGGGTGTGTTGTGGCTGG - Intergenic
958096074 3:88946726-88946748 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
958494456 3:94826520-94826542 GTTTAAGAGAATGTTGTGGCTGG + Intergenic
958661644 3:97076347-97076369 GCTTAACGGAATGTTGTGGCTGG - Intronic
958933106 3:100228841-100228863 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
959014408 3:101117031-101117053 GCTTAAGGAAATGTTGTGGCTGG - Intergenic
959030464 3:101293940-101293962 GGTTAAGGGAATGTTATGGCTGG + Intronic
959109762 3:102108260-102108282 GTTTAAGAGAATGTGGTGGCTGG + Intronic
959210194 3:103369056-103369078 GTTTAAGAAAATGTTGTGGCTGG + Intergenic
959238511 3:103756936-103756958 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
959290985 3:104474248-104474270 TCTTAAGGGAATGTTGTGGCTGG - Intergenic
959546371 3:107601540-107601562 GCTTAAGGGAGTGTTGTGGCTGG - Intronic
959721670 3:109497664-109497686 GCTTAAGGGAATGTTGTGGTTGG + Intergenic
959784341 3:110276288-110276310 TGTTAAGGGAATGTTGTGGCTGG - Intergenic
959821089 3:110736483-110736505 GCTTAATGAAATGTTGTGGCTGG + Intergenic
959869620 3:111311456-111311478 GTTTAAGCAAGAGTTTTGGTGGG + Intronic
959988398 3:112602621-112602643 GCTTAAGGGAATTTTGTGGCTGG - Intergenic
960179777 3:114562150-114562172 TCTTAAGGGAATGTTGTGGCTGG + Intronic
960381421 3:116967378-116967400 GCTTAAAGAAGTGCTGTGGCTGG + Intronic
960382739 3:116984601-116984623 GCTTAAGGGAATGTTGTGACTGG - Intronic
960549310 3:118956190-118956212 GCTTACAGAAATGTTGTGGCCGG + Intronic
960599458 3:119441447-119441469 GTTTAGGGCAATGTCGTGGCTGG - Intronic
960657387 3:120020951-120020973 GCTTAAGGAAATGTTGTGGTTGG - Intronic
960669081 3:120139627-120139649 GCTTAAGGGAATGTTATGGCTGG - Intergenic
960794079 3:121466151-121466173 GCTTAAGAGAATGTTGTGGCTGG - Intronic
960863238 3:122173805-122173827 GCTTAAGGTAATGTTGTGGTTGG + Intergenic
962711861 3:138093831-138093853 GCTTAAGGGAATTTTGTGGCCGG + Intronic
962836171 3:139190596-139190618 GCTTAAGGGAATGTTGTGGCTGG + Intronic
963198653 3:142563985-142564007 GCTTAAGGGAATGTTGTGGCTGG - Intronic
963293197 3:143514770-143514792 GCTTAAGGGAATGTTGTAGCTGG + Intronic
963507367 3:146203756-146203778 GCTTAAGGAAATGTTGTGACTGG + Intronic
963584480 3:147167158-147167180 GTCTAAAAAAGTATTGTGGCTGG + Intergenic
963746750 3:149131930-149131952 GCTTAAGGGAGTATTTTGGCTGG - Intronic
963773218 3:149410813-149410835 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
964126159 3:153235640-153235662 GCTGAAGGGAGGGTTGTGGCTGG - Intergenic
964398793 3:156276781-156276803 TATTAAGGGAATGTTGTGGCTGG + Intronic
964439962 3:156698072-156698094 GCTTAAGGGAATGTTGTAGCTGG - Intronic
964455845 3:156865198-156865220 CATTAAGGTAGTGTTGAGGCTGG + Intronic
964535035 3:157711639-157711661 GCTTAAAGGAATGTTGTGGCTGG - Intergenic
964673396 3:159251368-159251390 GTTTAAGGATGATTTGTGGTGGG - Intronic
965664320 3:171076203-171076225 ATATTAGGAAGTGTTGGGGCTGG - Intronic
965868008 3:173229265-173229287 GCTTAAGGGAATGTTGTGGCAGG + Intergenic
966214299 3:177486055-177486077 GTTTAAGGAACTATTCTGGTTGG + Intergenic
966368194 3:179214050-179214072 ACTTAAGGAAAAGTTGTGGCTGG + Intronic
966633193 3:182101993-182102015 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
966717449 3:183027736-183027758 GCTTAAGGGAATGTTGTGGCTGG - Intronic
966750839 3:183320613-183320635 GCTTAAGGAAATGTTGTGGGTGG + Intronic
966798551 3:183740539-183740561 GCTTAAGGGAATGTTATGGCTGG - Intronic
966995800 3:185279004-185279026 GCTTAAGGGAATGTTGTGGCTGG + Intronic
967077584 3:186017816-186017838 GCTTAAGGGAATGTTGTGACTGG + Intergenic
967266999 3:187699852-187699874 GTCTCAGGAAGTGTTGTGGGTGG + Intronic
967802754 3:193682190-193682212 GCTTAAGGGAATGTTATGGCTGG - Intronic
968438112 4:605980-606002 GCTTAAGGGAATGTTGTGGGTGG - Intergenic
969127739 4:4965639-4965661 GTGTAATGAAGTGTTTTTGCAGG - Intergenic
969280032 4:6163832-6163854 GCTTAAGGGAGTGTTGTAACTGG - Intronic
970284851 4:14500452-14500474 CATTAAGGAAATATTGTGGCTGG + Intergenic
970332056 4:14996823-14996845 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
970356713 4:15261131-15261153 GCTTAAGGGAATGTTTTGGCTGG - Intergenic
970605360 4:17675888-17675910 GGTTAAGGGAATGTTGTGGCTGG + Intronic
970847390 4:20556959-20556981 GTTTAAAGGAATTTTGTGGCTGG - Intronic
970945178 4:21682407-21682429 GCTTAAGGGGGAGTTGTGGCAGG + Intronic
971071239 4:23094525-23094547 ACTTAAGGAAATGTTGAGGCTGG - Intergenic
971164231 4:24166152-24166174 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
971868607 4:32206390-32206412 GTTTAAGGAAATGCTGTGGCTGG - Intergenic
971921366 4:32943744-32943766 GCTTAAGGGAAGGTTGTGGCTGG - Intergenic
972022943 4:34337726-34337748 GTCTAAGGGAATGTTATGGCTGG - Intergenic
972281758 4:37608481-37608503 GCTTAAGGGAATGTTGTGGCTGG - Intronic
972383678 4:38542983-38543005 GCTTAAGGACATGTTGTGGCTGG + Intergenic
972837365 4:42889357-42889379 GTTTAAGGGAATGTTGTGGTTGG - Intergenic
972954659 4:44374379-44374401 GCTGAAGGGAATGTTGTGGCTGG + Intronic
973128196 4:46615262-46615284 GCTTAAGTACATGTTGTGGCTGG - Intergenic
973696577 4:53496431-53496453 CTTTCAGGAAGGGTTGTGGCAGG - Intronic
973901224 4:55474242-55474264 GCTTAAGGGGATGTTGTGGCTGG - Intronic
974346543 4:60689688-60689710 GTGTAAGGGAAGGTTGTGGCTGG - Intergenic
974564126 4:63562106-63562128 GTTTGAGGAAATATTATGGCTGG - Intergenic
974656234 4:64826140-64826162 GTTTATGGGAATGTTGTGGCCGG + Intergenic
974701971 4:65462744-65462766 GTTTAATGGAGTGTTGTAGAAGG - Intronic
974791708 4:66699046-66699068 GCTTAAGAAAATGTTGTGGCTGG + Intergenic
975124879 4:70770607-70770629 GCTTAAGGGAATGTTGTGGCTGG + Intronic
975219932 4:71802899-71802921 GTGTAAGACAGGGTTGTGGCTGG - Intronic
975324725 4:73046469-73046491 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
975408720 4:74022827-74022849 CTTTAAGAATGTATTGTGGCCGG - Intergenic
975475493 4:74818603-74818625 GATTAAGAAAATGTTGTGGCTGG + Intergenic
975567929 4:75779556-75779578 GCTTAATGAAGTGTTGTGGCTGG - Intronic
975762020 4:77629866-77629888 GTTTAAGGGAATGTTGTAGGTGG + Intergenic
976058470 4:81097873-81097895 GGTTAAAGAAATGTTGTGTCTGG + Intronic
976154496 4:82128040-82128062 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
976468526 4:85399719-85399741 GTTTAAGAGGATGTTGTGGCTGG - Intergenic
976646979 4:87396812-87396834 GTTGAAGGGAATATTGTGGCTGG + Intergenic
976938680 4:90672481-90672503 GTTTAAGGGAATGTTATGGCTGG + Intronic
977024685 4:91802472-91802494 GTTTAAGGGAATGTAGTGGCTGG - Intergenic
977069816 4:92371016-92371038 GTGTAAGGGAATGTTGTGGCTGG - Intronic
977401169 4:96534478-96534500 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
977499659 4:97822905-97822927 GTTTAAGGAAATGTTGTGGCTGG - Intronic
977915762 4:102590932-102590954 GTAAAAGGGAATGTTGTGGCTGG - Intronic
978083044 4:104617863-104617885 GTTTAAGGGAATGTTTTGGATGG + Intergenic
978102759 4:104863075-104863097 ATTTAAGGTAATGCTGTGGCTGG + Intergenic
978123018 4:105104118-105104140 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
978125831 4:105134151-105134173 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
978249391 4:106611813-106611835 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
978260507 4:106751872-106751894 GCTTAAGGGTGTGTTATGGCTGG + Intergenic
978523507 4:109640699-109640721 GATTAAGGGAATGTTGTGACTGG + Intronic
978677048 4:111331141-111331163 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
978763031 4:112375617-112375639 GCTTAAGGGAGTGTTGTGGCTGG + Intronic
978805212 4:112792335-112792357 ATATAAGGATGTGTTGTCGCAGG - Intergenic
979043531 4:115832786-115832808 TTTTAAGAAAGTGTTGTGTCAGG - Intergenic
979190087 4:117846157-117846179 CTTTAAGGGAATGTTGTGGTTGG - Intergenic
979198045 4:117943188-117943210 GTTTAAGGGAATATTATGGCTGG - Intergenic
979247709 4:118528126-118528148 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
979384354 4:120046487-120046509 GCTTAAGGGAATGCTGTGGCTGG + Intergenic
979448859 4:120844975-120844997 GCTTAAGAGAATGTTGTGGCTGG - Intronic
979520840 4:121664843-121664865 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
979576855 4:122302804-122302826 GCTTAGGGGAATGTTGTGGCTGG - Intronic
979590362 4:122472144-122472166 GCTTAAGGAAATGTTGTGGCTGG - Intergenic
979667621 4:123329705-123329727 GCTTAAGGGAATGTCGTGGCTGG - Intergenic
979682951 4:123481512-123481534 TTTTAAAAAATTGTTGTGGCCGG + Intergenic
979729414 4:124006039-124006061 GTTTAAGGGAAAGTTGTGGCTGG + Intergenic
979823269 4:125200874-125200896 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
980009255 4:127578149-127578171 GTTTAAGCAAGTGTTGTCATGGG - Intergenic
980262850 4:130476570-130476592 ATTTAAGGGAATGTTGTCGCTGG - Intergenic
980504700 4:133701661-133701683 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
980529496 4:134033662-134033684 GCTTAAGTGAGTGTTGTGTCTGG - Intergenic
980635603 4:135497894-135497916 GTTTAAGGGAATGTTGTGGATGG + Intergenic
980768102 4:137334762-137334784 GCTTAAGGAAATGTCATGGCTGG + Intergenic
980858402 4:138468941-138468963 GTTTAAGGAGATGTTGTAGCTGG - Intergenic
980952845 4:139398682-139398704 GCCTAAGGGAATGTTGTGGCTGG + Intronic
981119582 4:141034362-141034384 GCTTAAGGGAATGTTGTAGCTGG + Intronic
981220878 4:142232879-142232901 GCTTAAGGGAATGTTGTGGCTGG - Intronic
981416513 4:144500121-144500143 ACTTAAGGGAATGTTGTGGCTGG - Intergenic
981462080 4:145025149-145025171 ACTTAAGGGAATGTTGTGGCTGG + Intronic
981464391 4:145050834-145050856 GCTTAAGGGAATGTTGTAGCTGG + Intronic
981493039 4:145361541-145361563 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
981764504 4:148232992-148233014 GCTTAAGAGAATGTTGTGGCTGG + Intronic
981806620 4:148723393-148723415 GCTTAAGAGAGTGTTGTGGCTGG + Intergenic
982021750 4:151211707-151211729 GCATAAGGGAATGTTGTGGCTGG - Intronic
982036347 4:151349740-151349762 GCTTAAAGGAATGTTGTGGCTGG - Intergenic
982152799 4:152480742-152480764 GCTTAAGGGAATATTGTGGCTGG - Intronic
982300454 4:153873410-153873432 GCTTACGGGAATGTTGTGGCTGG - Intergenic
982393126 4:154887252-154887274 TTTAAAGGAAGTGCTGTGCCTGG + Intergenic
982439081 4:155413704-155413726 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
982458892 4:155643418-155643440 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
982520632 4:156412334-156412356 GCTTAAGGGAATGTTGTGGCAGG + Intergenic
982681722 4:158439128-158439150 GCTTAAGGGAATATTGTGGCTGG - Intronic
983073727 4:163299584-163299606 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
983290214 4:165793238-165793260 ACTTAAGGAAATGTTGTGGCCGG + Intergenic
984038594 4:174700791-174700813 GCTTAAGGAAATGTTGTTGCTGG - Intronic
984174511 4:176399676-176399698 ACTTAAGGAAATGTGGTGGCTGG - Intergenic
984438990 4:179741683-179741705 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
984523570 4:180829333-180829355 GTTTAAAGAAGTGTTTATGCAGG - Intergenic
984567119 4:181344400-181344422 GTTTAAGGAAATGTTGTGGCTGG - Intergenic
984643181 4:182192877-182192899 GTTTAGGAAAGCTTTGTGGCTGG - Intronic
984741254 4:183165536-183165558 GTTTAAGGAATGGGTGTGGAAGG + Intronic
984898948 4:184567338-184567360 GCTTAAGGGAATGTTGTGGTTGG + Intergenic
984994911 4:185421158-185421180 GTTTAATGTAGTCTGGTGGCAGG + Intronic
985088097 4:186335145-186335167 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
985311080 4:188600087-188600109 GTTTAAGGGAATATTGTAGCTGG + Intergenic
986618038 5:9639861-9639883 GCTTAAGGAAATGTTGTGGCTGG + Intronic
987088921 5:14493905-14493927 GCTTAAGGCAAGGTTGTGGCTGG - Intronic
987124517 5:14799128-14799150 GCTTAAGGGAATGTTGTGGGTGG - Intronic
987237961 5:15962442-15962464 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
987328980 5:16838390-16838412 GCTGAAGGGATTGTTGTGGCTGG - Intronic
987611722 5:20212845-20212867 CCTTAAGGGAATGTTGTGGCTGG + Intronic
988055162 5:26085234-26085256 GTTTATGGGAGAGTTCTGGCAGG - Intergenic
988431680 5:31126222-31126244 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
988855864 5:35227810-35227832 ATGGAAAGAAGTGTTGTGGCTGG - Intronic
989001056 5:36761153-36761175 GTTTAAGGGAAGGTTGTGGCTGG + Intergenic
989258713 5:39395360-39395382 GTTGAAGGCAGGGTTGTGGAGGG - Intronic
989280746 5:39640329-39640351 GTTTAGAGAAGTGTTCTGGAAGG + Intergenic
989375038 5:40752207-40752229 GCTTAAGGGAATATTGTGGCTGG + Intronic
989532737 5:42526257-42526279 GCTTAAGAAAATGTTGTGGCTGG - Intronic
989634263 5:43517506-43517528 GTTTAAGGGAATGTTGTAGCTGG - Intergenic
989654077 5:43725550-43725572 GCTTAATGAAAGGTTGTGGCTGG + Intergenic
989667979 5:43878984-43879006 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
989760121 5:45005322-45005344 GTTTAAGGGAATATAGTGGCTGG - Intergenic
990068123 5:51743963-51743985 GCTGAAGGGAGTGCTGTGGCTGG + Intergenic
990572046 5:57088720-57088742 GTTTACAGGAATGTTGTGGCTGG - Intergenic
990788788 5:59453591-59453613 TCTTAAGGGAATGTTGTGGCTGG - Intronic
990832685 5:59977342-59977364 GCTTAAGGGAATGTTGCGGCTGG - Intronic
990835908 5:60019719-60019741 GTTTAAGGGAATGTTGTGGCTGG + Intronic
990874619 5:60470172-60470194 GTTTAAGGAAATGTTGTCACTGG - Intronic
991116381 5:62960677-62960699 GATTCAGTAAGTGTTGAGGCTGG + Intergenic
991188642 5:63841745-63841767 GCTTAAAGAAATATTGTGGCTGG - Intergenic
991191785 5:63882939-63882961 GCTTAAAGGAATGTTGTGGCTGG + Intergenic
991228651 5:64303565-64303587 GCTTAAGGGAATATTGTGGCTGG - Intronic
991366870 5:65877803-65877825 GCTTAAGGGAATGTTGTGACTGG - Intergenic
991413119 5:66364958-66364980 GTTTAAGGCAGTGTTGTGGCTGG + Intergenic
992362918 5:76060611-76060633 TCTTAAGGCAATGTTGTGGCTGG + Intergenic
992538199 5:77733514-77733536 GGTTAAGGCAATGTTGTGGCTGG - Intronic
992820816 5:80494151-80494173 GCTTAAGGGAATGTTGTGGCTGG - Intronic
992918316 5:81482665-81482687 GCTTAAGGGAATATTGTGGCTGG + Intronic
992922266 5:81538258-81538280 GCTTAAGGAAATGTTGTGGCTGG - Intronic
993771765 5:91937106-91937128 GCTTAAGGGAATGTTGAGGCTGG + Intergenic
994193169 5:96891652-96891674 TCTTAAGAAAGTGTTGTGGGGGG - Intronic
994253642 5:97566970-97566992 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
994298273 5:98116419-98116441 ATTTAAAGCAGTGTTGTAGCAGG + Intergenic
994517442 5:100788383-100788405 ACTTAAGGGAATGTTGTGGCTGG + Intergenic
994625929 5:102218886-102218908 GCTTAAGGGAATGTGGTGGCTGG + Intergenic
994827706 5:104736265-104736287 GCTTAAGGGAATTTTGTGGCTGG + Intergenic
995143510 5:108760734-108760756 GCTTGAGGAAATTTTGTGGCTGG + Intronic
995426381 5:112028170-112028192 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
995668918 5:114577780-114577802 GCTTAAGGAAACATTGTGGCTGG + Intergenic
995802144 5:116008677-116008699 GTTTAAGGGAATATTGTGGCTGG - Intronic
995886975 5:116906250-116906272 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
995989619 5:118221512-118221534 GATTAAGGGAATGTTGTGGCTGG + Intergenic
996067347 5:119093853-119093875 GCTTAAAGGAATGTTGTGGCTGG - Intronic
996209863 5:120794967-120794989 GATTAAGGGAATGTTGTGGATGG - Intergenic
996512487 5:124332446-124332468 GTTTAAAGGGATGTTGTGGCTGG + Intergenic
996586653 5:125095807-125095829 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
996673232 5:126144000-126144022 GCTTAAGGAAATGTGCTGGCTGG - Intergenic
996722181 5:126640592-126640614 GCTTAAGGGAATTTTGTGGCTGG - Intergenic
996841937 5:127856379-127856401 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
996847571 5:127917240-127917262 GCTTAAAGGAATGTTGTGGCTGG + Intergenic
997162948 5:131628357-131628379 GCTTAAGGGACTGTTGTGGCTGG - Intronic
997276937 5:132601292-132601314 GTTAAAAGAAGTTTTCTGGCCGG - Intronic
997330396 5:133056164-133056186 GTTTGAGGAAGAGTTGTTCCAGG + Intronic
997577214 5:134989658-134989680 GTTTTAAGGAATGTTGTGGCTGG + Intronic
998270504 5:140702191-140702213 GTTTTAGGAAGTGTTAAGGAAGG + Intronic
998831388 5:146163263-146163285 GCTGAAGGAAATGTTGTGGCTGG + Intronic
998847023 5:146320541-146320563 GTTTAAGGGAATATTGTGGCTGG - Intronic
998863734 5:146473235-146473257 GCTTAATGAAATGTTGTAGCTGG - Intronic
998883160 5:146665500-146665522 GCTTAAGGAAATGTTGTGGCTGG + Intronic
998989263 5:147797407-147797429 GCTTAAGGGAATATTGTGGCTGG - Intergenic
999524625 5:152391025-152391047 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
999551523 5:152692580-152692602 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
999835119 5:155361832-155361854 GCTTAAGGAAATGTTGTGATTGG + Intergenic
999884547 5:155906604-155906626 GCTTAAGGGAATGTTGTGGCTGG - Intronic
999897126 5:156047061-156047083 GCTTAAAGAAATGTTGTGGCTGG - Intronic
1000302868 5:159971916-159971938 GTTCAAGGTGGTGTTCTGGCTGG + Exonic
1000312576 5:160059413-160059435 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1000389230 5:160705647-160705669 GCTTAAGGGAGTGTTGTGGCTGG + Intronic
1000586685 5:163108489-163108511 GGTTAAGGGAATGTTATGGCTGG + Intergenic
1000661195 5:163940743-163940765 GCTGAAGGGAATGTTGTGGCTGG - Intergenic
1000821284 5:165987614-165987636 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
1000863370 5:166483681-166483703 GCTTAAGGAAATGTCGTGTCTGG + Intergenic
1002813124 6:653481-653503 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1002958808 6:1895090-1895112 TTATAAGGCATTGTTGTGGCAGG + Intronic
1003187713 6:3847538-3847560 GTTTAAGGGAATGTCGTGGCTGG + Intergenic
1003431378 6:6041621-6041643 GGATAAAGAAGTGTTGTGCCTGG - Intergenic
1003473206 6:6456639-6456661 GCTTAAGAAAATATTGTGGCTGG - Intergenic
1003598734 6:7499021-7499043 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1003660001 6:8051290-8051312 GCTTAAGAAAATGTTGTGGCTGG - Intronic
1003662686 6:8077673-8077695 GATTAAGAGAATGTTGTGGCTGG + Intronic
1003830913 6:10010424-10010446 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1003996154 6:11541519-11541541 GCTTAGGGGAGTGTTGTAGCTGG + Intronic
1004067916 6:12267470-12267492 GCTTAAGGAAATGCTGTGCCTGG - Intergenic
1004152811 6:13136443-13136465 GCTTAAGGGAATATTGTGGCTGG + Intronic
1004926653 6:20422337-20422359 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1004978564 6:20996159-20996181 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1005045865 6:21641799-21641821 GCTTAAGGAGTTATTGTGGCTGG - Intergenic
1005365754 6:25075157-25075179 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1006262013 6:32882612-32882634 GGTTAAGGAAGTGATGGGGGTGG + Intergenic
1006741064 6:36309346-36309368 GGTCAGGGAAGTGTTGGGGCTGG - Intergenic
1006959626 6:37915250-37915272 GTTTAAGGGAATATTATGGCTGG + Intronic
1007017739 6:38486191-38486213 GCTTTAGGGAATGTTGTGGCTGG + Intronic
1007045749 6:38772759-38772781 ATCTAAGGAAGTGTTGTGTGGGG + Intronic
1007352508 6:41284163-41284185 GTTTCAGGGAGAGTTGTGGCGGG - Intronic
1007379657 6:41479959-41479981 GCATAAGGGAATGTTGTGGCTGG - Intergenic
1007489756 6:42210323-42210345 GTTTATGGAAGTGTCATGGTAGG - Intronic
1008112538 6:47508477-47508499 GCTTAGGGAAAAGTTGTGGCTGG + Intronic
1008117914 6:47574057-47574079 GTTTCAGAAACTGTTTTGGCTGG + Exonic
1008152230 6:47967857-47967879 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1008197653 6:48544319-48544341 GCTTAAGGAAAGGTTGTGGCTGG + Intergenic
1008271042 6:49490428-49490450 GTTTAAGGGAATGTCGTGGCTGG + Intronic
1008319448 6:50090139-50090161 GCTTAAGGTAATGTTGTGGCTGG - Intergenic
1008390780 6:50948969-50948991 GCTTAAGGGAGTGTTGCAGCTGG - Intergenic
1008597553 6:53058347-53058369 TGCTAAGGAAATGTTGTGGCAGG - Intronic
1008622535 6:53285306-53285328 GCTTAAGGGAATGTTATGGCTGG - Intronic
1008812572 6:55522055-55522077 GCTTAGGGGAATGTTGTGGCTGG - Intronic
1008831606 6:55770459-55770481 GTATAAAGGAATGTTGTGGCTGG + Intronic
1009040841 6:58175121-58175143 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1009216698 6:60929653-60929675 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1009440772 6:63675587-63675609 GTTGAAGGAAGTGTGTTGTCAGG + Intronic
1009479345 6:64137250-64137272 GTTTAAGAGAATGTTGTGGTTGG + Intronic
1009573518 6:65421421-65421443 GCTTGAGGAAATGTTGTGGCTGG + Intronic
1009627341 6:66152206-66152228 GCTTAAAGAAATGTTGTGTCTGG - Intergenic
1009960803 6:70518228-70518250 ACTTAAGGCACTGTTGTGGCTGG - Intronic
1009970343 6:70618764-70618786 GTTTAAGGGAATGTTGTTGCTGG - Intergenic
1009984206 6:70763776-70763798 GCTTAAGGAAATGTTGTGGCTGG - Intronic
1010067436 6:71700850-71700872 GCTTAAGGGAATGTTATGGCTGG - Intergenic
1010110620 6:72225565-72225587 GTTTAAGAAATTGTTGTGCTGGG - Intronic
1010288860 6:74112398-74112420 GTTTAAGAGAATGTTGTGGCTGG - Intergenic
1010566061 6:77415573-77415595 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1010697356 6:78993100-78993122 GCTTAAGGGAATGTTGTAGCTGG - Intronic
1010846510 6:80715764-80715786 TTTTAAGTTAGTGTTGTGTCAGG + Intergenic
1011019815 6:82800131-82800153 GGTTAAGGGAATGTTGTGGCTGG - Intergenic
1011060708 6:83263593-83263615 GCTTAAGGAAATGTTGTGACTGG - Intronic
1011069791 6:83367726-83367748 CTTAAAGGGAATGTTGTGGCTGG + Intronic
1011115694 6:83888972-83888994 GCTTAAGAGAATGTTGTGGCTGG - Intronic
1011644798 6:89447366-89447388 GCTTTAGGGAATGTTGTGGCTGG - Intronic
1011653566 6:89529448-89529470 GTTCAAGGGAATGTTGTGTCTGG + Intronic
1011872030 6:91907490-91907512 GCTTAAGGGAATGTTGTGTCTGG + Intergenic
1012092839 6:94920592-94920614 GCTTAAGGGAATGCTGTGGCAGG - Intergenic
1012207834 6:96482905-96482927 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1012287649 6:97412467-97412489 ATTTAAGCAAATGTTGTGGCTGG + Intergenic
1012392631 6:98760351-98760373 GTTTCAGGGAATGTTGTAGCTGG - Intergenic
1012702543 6:102478907-102478929 GCTTATGGAAATGTTGTGACTGG + Intergenic
1013172718 6:107651376-107651398 GATTAAGGAAATATTGTGGTCGG - Intronic
1013381910 6:109581504-109581526 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1013414725 6:109914467-109914489 CTTTAAAGGAGTGTTGTGGTTGG - Intergenic
1013712906 6:112922199-112922221 GTTTAAAGGAATGTTGTAGCTGG - Intergenic
1013933129 6:115559553-115559575 GTTTAAGGGAATGTTGTTACTGG - Intergenic
1014060890 6:117070397-117070419 GATAAAGAAAGTGTGGTGGCCGG - Intergenic
1014263893 6:119252495-119252517 GATTCAAGAAGTTTTGTGGCTGG + Intronic
1014742416 6:125161284-125161306 ACTTAAAGAAATGTTGTGGCTGG + Intronic
1014928411 6:127303463-127303485 GCTTAAGGAAATGCTGTGGCTGG - Intronic
1015009948 6:128333649-128333671 GCTTAAGGGAATGCTGTGGCTGG + Intronic
1016081631 6:139864366-139864388 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
1016199395 6:141389118-141389140 TTTTAAGGGAATGTTGTGGCTGG + Intergenic
1016220333 6:141661349-141661371 GATTAAGGCAATGTTGTGGCTGG + Intergenic
1016257244 6:142122211-142122233 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1016344142 6:143093430-143093452 GCTTAAGGGAATGTTGTGTCTGG + Intronic
1016490880 6:144600492-144600514 GCTTAAGGAAATGTTGTGACTGG - Intronic
1016794093 6:148099362-148099384 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1016867427 6:148781345-148781367 GCTTAACGCAATGTTGTGGCTGG - Intronic
1016946196 6:149536567-149536589 GCTTAAGGGATCGTTGTGGCTGG - Intronic
1017183995 6:151582455-151582477 GCTTAAGGGAATGTTATGGCTGG + Intronic
1017243701 6:152198337-152198359 GCTTAAAGGAATGTTGTGGCTGG + Intronic
1017298248 6:152825232-152825254 GCTTAAGGGAATGTTGTGGTGGG + Intergenic
1017355210 6:153497090-153497112 GCCTAAGGGAATGTTGTGGCTGG - Intergenic
1017443061 6:154482362-154482384 GATTTAGGATGTTTTGTGGCAGG - Intronic
1017734706 6:157350819-157350841 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1018005107 6:159614334-159614356 GTTTCACAAAGTGTTGTGGATGG + Intergenic
1018076564 6:160221360-160221382 GCTTAAGGGAATGTTGTGACCGG + Intronic
1018207752 6:161451435-161451457 GTTGATGGAAGTGTAGTGACAGG - Intronic
1018250552 6:161865730-161865752 GCTTAAGGGAGTGTTGTGGCTGG + Intronic
1018587290 6:165375370-165375392 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1019159540 6:170060031-170060053 GCCTAAGGGAATGTTGTGGCTGG - Intergenic
1020423838 7:8041208-8041230 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1020548987 7:9573883-9573905 GCTTAAGGGAATGTTTTGGCTGG + Intergenic
1020697968 7:11439652-11439674 GTTTAAGGGAATGTTCTGACTGG - Intronic
1020758615 7:12239317-12239339 ACTTAAGGCAATGTTGTGGCTGG + Exonic
1020859768 7:13476858-13476880 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1021204450 7:17763037-17763059 GCTTAAGGGAATGTTTTGGCTGG + Intergenic
1021221735 7:17982255-17982277 GTTTAAGGGAATGTTGTGTCTGG + Intergenic
1021310754 7:19093062-19093084 GTTTATGGATGGGTTGTGGATGG + Intronic
1021376547 7:19914784-19914806 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1021733020 7:23615367-23615389 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1022063330 7:26823515-26823537 GCTTAAGGGAGTGTTGTAGCTGG - Intronic
1022145008 7:27528530-27528552 GTTTAAGGGAATGTTTTGGCTGG - Intronic
1022594585 7:31700319-31700341 GCTTAAGGAAGGGTTATGGCTGG - Intronic
1022951402 7:35341800-35341822 GCTAAAGGGAATGTTGTGGCTGG - Intergenic
1022958882 7:35406261-35406283 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1023356057 7:39368312-39368334 GCATAAGGGAGTGTTGTGGCTGG - Intronic
1023514769 7:40990911-40990933 AATTAAGGGAATGTTGTGGCTGG + Intergenic
1023645354 7:42306983-42307005 GGTTCAGGAAATGTTATGGCTGG - Intergenic
1023667348 7:42537622-42537644 GCTTAAGGAGATGTTGTAGCTGG - Intergenic
1023773210 7:43578907-43578929 GCTTAAGGGAATCTTGTGGCTGG + Intergenic
1024133330 7:46379833-46379855 GCTTGAGGGAATGTTGTGGCTGG - Intergenic
1024257986 7:47553014-47553036 GCTTAAGGGAATGTGGTGGCTGG - Intronic
1024549339 7:50548502-50548524 GCTTAAGGAAATGTTGTGGCTGG - Intronic
1024762945 7:52622276-52622298 GTTTAAGAAAGTTTTGGGCCTGG + Intergenic
1024837918 7:53545739-53545761 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1025073306 7:55920450-55920472 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1025195941 7:56933602-56933624 GCTTAAGAAAATGTTGTCGCTGG - Intergenic
1025676007 7:63643334-63643356 GCTTAAGAAAATGTTGTCGCTGG + Intergenic
1025745436 7:64238682-64238704 TTCTAAAGTAGTGTTGTGGCTGG - Intronic
1025938458 7:66056277-66056299 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1025945989 7:66104936-66104958 GCTTAAGGGAATGTTGTGACTGG + Intronic
1026330388 7:69347081-69347103 GTATAAGGGAATGCTGTGGCTGG + Intergenic
1026457103 7:70582307-70582329 GTGGAAGGAAGGGTTGGGGCTGG - Intronic
1026507756 7:71000410-71000432 GCTTAAGGGAATGTTGTGACTGG - Intergenic
1026590363 7:71689463-71689485 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1026642124 7:72136444-72136466 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1027006069 7:74694152-74694174 GCTTAAGGGAATGCTGTGGCTGG - Intronic
1027747815 7:82099743-82099765 GTTTAAGAAGGTATTGCGGCCGG - Intronic
1028178280 7:87683205-87683227 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1028296637 7:89140711-89140733 GTTTAAGGGAATGTTGTGGCTGG + Intronic
1028372325 7:90107263-90107285 GCTTAAGGGAAGGTTGTGGCTGG + Intergenic
1028695995 7:93713307-93713329 GCTTAAGAAAATGTTGTTGCTGG - Intronic
1028870554 7:95767048-95767070 GATAAAGGGAATGTTGTGGCTGG - Intergenic
1029049960 7:97675350-97675372 GCTTAAGGGAATATTGTGGCTGG - Intergenic
1029674195 7:102055960-102055982 GCTTAAGAGAATGTTGTGGCTGG - Intronic
1030387338 7:108880433-108880455 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1030827027 7:114170663-114170685 GCTTAGGGGAATGTTGTGGCTGG - Intronic
1031057350 7:117007327-117007349 GCTTAAGGGAATGTTATGGCTGG - Intronic
1031215221 7:118881927-118881949 GCTTAAGGAAATCTTGTGGCTGG - Intergenic
1031336321 7:120537842-120537864 TCTTAAGGAAATGTTGTGGCTGG + Intronic
1031498761 7:122485446-122485468 GTTTAAGGGAATATTGTGGCTGG - Intronic
1031588578 7:123562697-123562719 GCTTAAGGGAATGTTGTGGATGG + Intergenic
1031654833 7:124341842-124341864 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1031719240 7:125149655-125149677 GTTTAAGGCATTGTGTTGGCAGG + Intergenic
1031735857 7:125360556-125360578 GTTTAAGGTAATGGTGTGGCTGG + Intergenic
1031815254 7:126425798-126425820 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
1031827315 7:126582276-126582298 GTTTAAGGGAATGTTGTGGATGG - Intronic
1031860193 7:126970537-126970559 GCTTATGGGAATGTTGTGGCTGG + Intronic
1031921514 7:127605163-127605185 GCTTAAGAGAGTGTTATGGCTGG + Intergenic
1031954785 7:127931305-127931327 GCTTAAGGAAATATTGTGACTGG - Intronic
1032002884 7:128276703-128276725 GTCTAAGGAAGTGGGGGGGCAGG + Intergenic
1032374875 7:131403366-131403388 GCTTAAGGGAGTGTTATGACTGG + Intronic
1032558588 7:132863926-132863948 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1032701678 7:134385854-134385876 GCTTAAAGAAATGTTGTGGCTGG - Intergenic
1032814628 7:135460129-135460151 GTTTAAGGAAATTATGTGACTGG + Intronic
1032861783 7:135886807-135886829 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1033080541 7:138292822-138292844 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1033241659 7:139684909-139684931 GCTGAAGGGAGTGTTGTGGCTGG - Intronic
1033386467 7:140881333-140881355 ACTTAAGGAAATGTTGTGGCTGG + Intronic
1033388473 7:140902861-140902883 ACTTAGGGAAATGTTGTGGCTGG - Intronic
1034022141 7:147656165-147656187 GCTTAAGGGAATGTTGTGGTTGG + Intronic
1034028192 7:147730932-147730954 GCTTAAGGGAATGTTGTGGTTGG - Intronic
1034361665 7:150505161-150505183 GCTTAAGGGAATGTTGCGGCTGG - Intergenic
1034611722 7:152376555-152376577 GCTTAAGGGAATGTTATGGCTGG - Intronic
1034917435 7:155052478-155052500 CTTTAAAGAAGAGTTTTGGCCGG + Intergenic
1035036075 7:155895180-155895202 GCTTCAGGGAATGTTGTGGCTGG - Intergenic
1035144432 7:156799902-156799924 GCTTTAGGGAATGTTGTGGCTGG - Intronic
1035351749 7:158252274-158252296 GATTATGGGAGTGGTGTGGCAGG - Intronic
1035387115 7:158480742-158480764 GCTTAAGGGAATATTGTGGCTGG - Intronic
1035958808 8:4113800-4113822 GTTTAAGGGAATGTTGTAGCTGG - Intronic
1036088824 8:5642497-5642519 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
1036197989 8:6737978-6738000 CTTTAAGGGAGTGTTGTGGCTGG + Intronic
1036388280 8:8301402-8301424 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
1036459996 8:8943905-8943927 TATAAAGGAAGTGTTCTGGCAGG + Intergenic
1038526981 8:28283210-28283232 GCTGAAGGGAATGTTGTGGCTGG - Intergenic
1038837606 8:31144906-31144928 GCTCAAGGGAATGTTGTGGCTGG - Intronic
1039192328 8:34990835-34990857 GGTTAAGGGAATGTTGTGGCTGG - Intergenic
1039381992 8:37094215-37094237 GCTTAAGGGAGTACTGTGGCTGG - Intergenic
1039384054 8:37115878-37115900 CCTTAAGGACATGTTGTGGCTGG + Intergenic
1039556309 8:38477810-38477832 GCTTAAGGGAATGTTATGGCTGG - Intergenic
1039652662 8:39359071-39359093 GCTTGAGGGAATGTTGTGGCCGG - Intergenic
1039983883 8:42431320-42431342 ACTTAAGGGAATGTTGTGGCTGG - Intronic
1040036814 8:42878468-42878490 GCTTAAGGAAATGTTGTGGCTGG - Intronic
1040058109 8:43078952-43078974 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1040076050 8:43232057-43232079 GCTTAAGGAAGCGTTATGGCTGG + Intergenic
1040636299 8:49277603-49277625 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1040701688 8:50074352-50074374 GGTTTAAGAAGAGTTGTGGCTGG + Intronic
1040754066 8:50749214-50749236 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1040800549 8:51335068-51335090 GTTTAATGAAGTGAGGAGGCTGG + Intronic
1040908221 8:52491032-52491054 TTTTAAAGAATTGTGGTGGCTGG - Intergenic
1040935215 8:52775293-52775315 GTTAAATAAAGGGTTGTGGCTGG - Intergenic
1041055435 8:53981011-53981033 GCTTAAGGGAATGTTGTGGTTGG - Intronic
1041372524 8:57177737-57177759 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1041432331 8:57796750-57796772 ATTGAAGGGAATGTTGTGGCTGG - Intergenic
1041770029 8:61463247-61463269 GCTTAAGGAAATGTTGCGGCTGG + Intronic
1042140390 8:65672888-65672910 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1042548044 8:69968427-69968449 GCTTAAGGGAATGCTGTGGCAGG - Intergenic
1042575020 8:70208181-70208203 ATTTAAGGGAATCTTGTGGCTGG - Intronic
1042719273 8:71809405-71809427 GTTTTAGGATGCGATGTGGCAGG - Intergenic
1042795478 8:72658321-72658343 GCATAAGGAAATGTTGTGGCTGG - Intronic
1042829585 8:73011794-73011816 GCTTAAAGGAATGTTGTGGCTGG + Intronic
1043275747 8:78390094-78390116 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1044030866 8:87235156-87235178 ATTTAAGAGAATGTTGTGGCTGG + Intronic
1044114341 8:88316000-88316022 GCTTAAGGGAACGTTGTGGCTGG - Intronic
1044245746 8:89943076-89943098 TTTTAAAGAAGTGTTATGGAAGG + Intronic
1045038611 8:98198802-98198824 GCTTAAGGGAATGTTGTGACTGG + Intronic
1045073142 8:98531951-98531973 GCTTAAGGAAATGTTGTGACTGG + Intronic
1045085717 8:98681844-98681866 TTTTAAACAAGTGTTTTGGCAGG - Intronic
1045381148 8:101627842-101627864 GCCTAAGGGAATGTTGTGGCTGG - Intronic
1045541866 8:103094337-103094359 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1045563509 8:103289616-103289638 GCTTAAGGGAATGTTATGGCTGG + Intergenic
1045670325 8:104544152-104544174 GCTTAAGGCGATGTTGTGGCTGG - Intronic
1045889572 8:107138895-107138917 GTTTAAGGGAATGTTCAGGCTGG + Intergenic
1045907799 8:107369349-107369371 GCTTAAGGTAATGTCGTGGCTGG + Intronic
1046130344 8:109959940-109959962 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1046168593 8:110473747-110473769 GTTTAAGGGAATGTTGTGATTGG + Intergenic
1046316768 8:112513050-112513072 GCTTATGGGAATGTTGTGGCTGG + Intronic
1046534125 8:115486677-115486699 GCTTAAGGGAATATTGTGGCTGG - Intronic
1047009869 8:120660518-120660540 GCTTAAGGAAATGTGGTGGTTGG + Intronic
1047106478 8:121736348-121736370 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
1047400681 8:124544143-124544165 GCTTAAGGGAATGTCGTGGCTGG - Intronic
1047888817 8:129283796-129283818 GCTTAAGGGTATGTTGTGGCTGG - Intergenic
1048119319 8:131562637-131562659 GTTTAAAAGAGTGATGTGGCCGG + Intergenic
1048163142 8:132039032-132039054 GTTCAGGGAAGAGTTGAGGCTGG + Exonic
1048510083 8:135054423-135054445 GTGTAAGGAAGTGATTTGGGAGG - Intergenic
1048603403 8:135942903-135942925 GTGGAAGGAAGTGCTGTGGGAGG - Intergenic
1048604974 8:135958301-135958323 GCTTAAGACAGTGTTTTGGCTGG - Intergenic
1049136665 8:140908202-140908224 GCTTAAGGGAATGTTGTGACTGG - Intronic
1049314216 8:141951621-141951643 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1050383760 9:5061609-5061631 GCTTAAGGGAATGTTATGGCTGG + Intronic
1051147170 9:14039643-14039665 GTTTAAGGGAGTGCTGTGGCTGG + Intergenic
1051254161 9:15195220-15195242 GCTTAAGGGAGTGTTGTGGGTGG - Intronic
1051266275 9:15312091-15312113 GGTTAAGAGAATGTTGTGGCTGG - Intergenic
1051305414 9:15703231-15703253 GCTTAAGAGAATGTTGTGGCTGG + Intronic
1051330083 9:16015365-16015387 GCTTAAGAGACTGTTGTGGCTGG + Intronic
1051473514 9:17476634-17476656 GCTTAAGAAACTGTTGTGACTGG - Intronic
1051753649 9:20371052-20371074 GTTTAAGGAAGTGTTGTGGCTGG - Intronic
1051967914 9:22851437-22851459 GCTTAAGGGAATGTTGTGCCTGG + Intergenic
1052111309 9:24586369-24586391 GCTTAAGGGGATGTTGTGGCTGG + Intergenic
1052186627 9:25604750-25604772 GATTAAGGGGATGTTGTGGCTGG - Intergenic
1052371328 9:27668202-27668224 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1052499036 9:29265367-29265389 GTTTAAGGGCATGTTGTGGTTGG - Intergenic
1053172457 9:35899028-35899050 GTTTCAGGGAATGTTGTGGCTGG + Intergenic
1053217731 9:36286498-36286520 GCTAAAGGGAATGTTGTGGCTGG + Intronic
1053296558 9:36918688-36918710 GTTAAAGGGAATGTTGTGGCTGG - Intronic
1053465601 9:38305713-38305735 GCTTAAGGAAATCTTGTGGCTGG + Intergenic
1053575109 9:39351749-39351771 GCTTAAGGAAATGTTGTGGTTGG - Intergenic
1053578936 9:39382898-39382920 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
1053839614 9:42179684-42179706 GCTTAAGGAAATGTTGTGGTTGG - Intergenic
1053843452 9:42210973-42210995 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
1054096673 9:60910432-60910454 GCTTAAGGAAATGTTGTGGTTGG - Intergenic
1054100519 9:60941702-60941724 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
1054118076 9:61186058-61186080 GCTTAAGGAAATGTTGTGGTTGG - Intergenic
1054121916 9:61217327-61217349 GTTTAAGGGAATGTTGTGGCTGG + Intergenic
1054585828 9:66965184-66965206 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
1054589680 9:66996506-66996528 GCTTAAGGAAATGTTGTGGTTGG + Intergenic
1054795770 9:69300461-69300483 GTTTAAGGGAATATTGTGGCTGG + Intergenic
1054994532 9:71370493-71370515 GCCTAAGGGAATGTTGTGGCTGG - Intronic
1055039434 9:71853069-71853091 GCCTAAGGGAATGTTGTGGCTGG + Intergenic
1055189976 9:73506944-73506966 GTTTAAGGAAATGTGGTGCCTGG - Intergenic
1055547531 9:77394935-77394957 GCTTGAAGAAATGTTGTGGCTGG + Intronic
1056093760 9:83230387-83230409 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1056181700 9:84089850-84089872 GCTTAAGGAAATAGTGTGGCTGG + Intergenic
1056191323 9:84187204-84187226 GGTTAAGGGAGTGTTGTGGCTGG - Intergenic
1056751951 9:89358198-89358220 GCTTAAGGGAGAGTTGTGTCAGG + Intronic
1057240338 9:93402219-93402241 GCATAAGGAAATGTTGTGGCTGG - Intergenic
1057539021 9:95947300-95947322 GTTTAATGGAATGCTGTGGCTGG - Intronic
1057823679 9:98354717-98354739 ACTTAAGGGAATGTTGTGGCTGG + Intronic
1058196397 9:101982183-101982205 GCTTAAGGGAGTGTAGTGGCTGG - Intergenic
1058348755 9:103996557-103996579 ATTTAAGGGAATGTTGTGGCTGG + Intergenic
1058638775 9:107062860-107062882 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1058927999 9:109687603-109687625 GCTAAAGGGAATGTTGTGGCTGG + Intronic
1058932341 9:109733415-109733437 GTGGGAGGAAGTGTTGTGTCTGG + Intronic
1059129499 9:111731127-111731149 GCTTAAGGGAATATTGTGGCTGG + Intronic
1059158137 9:112008058-112008080 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1059572484 9:115454428-115454450 GCTTAAGGGAATGTTGTGGATGG + Intergenic
1059603426 9:115806787-115806809 GCTTAAGGGAATGTTGTAGCTGG + Intergenic
1059711874 9:116875321-116875343 GTTTAAGGGAATATTGTAGCTGG - Intronic
1059833677 9:118127018-118127040 GTTTAAGGGAATGTTGTGGCTGG - Intergenic
1059844306 9:118255617-118255639 ACTTAAGGAAATATTGTGGCTGG - Intergenic
1059881980 9:118701161-118701183 GCTTAAGGAAGTGTTTTTGAAGG - Intergenic
1060460459 9:123848855-123848877 GTGTAAGGGAATGTTGTGGCTGG - Intronic
1061340515 9:129976867-129976889 ATTAAAAGAACTGTTGTGGCTGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061784361 9:133017370-133017392 GCTTAAGGGAATGCTGTGGCTGG - Intergenic
1062669656 9:137700437-137700459 GTCTAAGGCACTGATGTGGCTGG - Intronic
1185572883 X:1147873-1147895 GTGGGAGGAAGTGTGGTGGCAGG - Intergenic
1186255984 X:7720344-7720366 GCTTAAGAGAGTATTGTGGCTGG + Intergenic
1186535776 X:10346453-10346475 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1186706794 X:12148360-12148382 GCTTAACGGAATGTTGTGGCTGG - Intronic
1187110858 X:16298409-16298431 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1187311053 X:18143235-18143257 GCTTAAAGGAATGTTGTGGCTGG - Intergenic
1187474418 X:19598152-19598174 GCTTAAAGAAGTGTTGTGGCTGG + Intronic
1187516644 X:19977459-19977481 GCTTAAGGGAACGTTGTGGCTGG - Intergenic
1187662901 X:21570460-21570482 GTTTAAGGGAATGTTATGGCTGG + Intronic
1187662950 X:21570961-21570983 GTGTAAGGGAATGTTGTGGCTGG + Intronic
1187760152 X:22574290-22574312 GCTTAAGGAAGTGTTGTGGCTGG - Intergenic
1187890425 X:23929445-23929467 GTTTAAGGGAATATTGTGGCTGG - Intronic
1188139127 X:26526614-26526636 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1188216244 X:27480830-27480852 GGTTAAGGAAGGGATGTGTCAGG + Intergenic
1188238072 X:27753256-27753278 GCTTAAGGGAATGTTGTGGTCGG - Intergenic
1188432677 X:30122936-30122958 GTTTAAGGGAATGTTGTGAATGG - Intergenic
1188705363 X:33322008-33322030 GGTTAAGGGAATATTGTGGCTGG + Intronic
1188844411 X:35055880-35055902 GTTTAAGAGAATGTTGTGGGTGG + Intergenic
1188855592 X:35191333-35191355 GTTTAAGGGAATTTTGTGCCTGG + Intergenic
1189060128 X:37744772-37744794 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1189788045 X:44577397-44577419 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1189830224 X:44965193-44965215 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1189917347 X:45869278-45869300 GTTTAAAGAAGTGTTGTTAGAGG - Intergenic
1189930837 X:46007959-46007981 GCTTAAGGAAATGTTGTGGCTGG + Intergenic
1189965000 X:46363306-46363328 GCTTAGGGGAGTGTTGTGGCTGG + Intergenic
1190141896 X:47854282-47854304 AATTAAGGGAATGTTGTGGCTGG + Intronic
1190171943 X:48118313-48118335 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1190177540 X:48163669-48163691 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1190180636 X:48188949-48188971 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1190183577 X:48215668-48215690 GCTTAAGTCAATGTTGTGGCTGG + Intronic
1190189480 X:48265068-48265090 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1190193684 X:48298452-48298474 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1190196651 X:48325361-48325383 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1190199553 X:48348806-48348828 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1190204343 X:48390644-48390666 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1190206193 X:48404759-48404781 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1190210181 X:48440294-48440316 GCTTAAGGGAATGTTGTGGCTGG + Intergenic
1190460787 X:50671675-50671697 GGCTAAGGGAATGTTGTGGCTGG + Intronic
1190492344 X:50994537-50994559 GTTTAAGGATGTGTTTTAACTGG - Intergenic
1190655146 X:52605362-52605384 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1190658241 X:52631570-52631592 GCTTAAAGGAATGTTGTGGCTGG + Intergenic
1190660204 X:52647082-52647104 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1190663378 X:52675731-52675753 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1190666327 X:52699251-52699273 GCTTAAGGGAATGTTGTGACTGG - Intronic
1190673091 X:52759159-52759181 GCTTAAGGGAATGTTGTGACTGG + Intronic
1190676045 X:52782751-52782773 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1191773842 X:64790959-64790981 GCTTAAGGGAATGTTGTGGTTGG - Intergenic
1191836677 X:65470524-65470546 GATTAAGGAAGAGTTGAGGAGGG - Intronic
1192084579 X:68083470-68083492 GCTTAAGGGAATGTTGTGGCTGG + Intronic
1192091668 X:68165071-68165093 GTTTAAGGGAATGTTGTGGTTGG + Intronic
1192301892 X:69913525-69913547 GCTTAAAGAAATGTTGTAGCTGG + Intronic
1192421023 X:71030669-71030691 GTTCAAGGTAGTATTGTGACAGG + Intergenic
1192667635 X:73104449-73104471 GCTTAAGGGAATGTTGTGGCTGG - Intergenic
1193396095 X:80985306-80985328 GCTAAAGGGAATGTTGTGGCAGG + Intergenic
1193906041 X:87245336-87245358 GTTTAGGGGAATGTTGTGGTTGG - Intergenic
1194588656 X:95769706-95769728 GCTTAAGGGAGTGTTGTGGCTGG - Intergenic
1194591255 X:95802733-95802755 GCTTAATGAAGTTTTGTGGTTGG - Intergenic
1194875262 X:99179172-99179194 GCTTAAGGTAATATTGTGGCTGG + Intergenic
1195253263 X:103068585-103068607 GCTTAAGGGAGTGTTGTGGCTGG - Intergenic
1195628363 X:107028034-107028056 GCTTAAGGGAATGTTGTGGTTGG + Intergenic
1195792596 X:108604988-108605010 GCTTAAGGGAATGTTATGGCTGG + Intronic
1196547913 X:116986142-116986164 GTTTAAGGGACTCTTATGGCTGG + Intergenic
1196971591 X:121115478-121115500 GCTGAAGGGAATGTTGTGGCTGG + Intergenic
1197423260 X:126264320-126264342 GCTTAAGGGAATATTGTGGCTGG + Intergenic
1197529241 X:127602393-127602415 GCGTAAGGGAATGTTGTGGCGGG - Intergenic
1197687395 X:129455709-129455731 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1198199717 X:134403341-134403363 GCTTAAGGGAATGTTGTGGCTGG - Intronic
1198281379 X:135146162-135146184 GCTCAAGGGAATGTTGTGGCTGG + Intergenic
1198289580 X:135226354-135226376 GCTCAAGGGAATGTTGTGGCTGG - Intergenic
1198304856 X:135370248-135370270 GCTTGAGGAAATGTTGTAGCTGG - Intergenic
1198490559 X:137136032-137136054 GCTTAAGGGAATTTTGTGGCTGG + Intergenic
1198542929 X:137659512-137659534 GGTTAAGGGAGTGTTGTGGCTGG - Intergenic
1199090619 X:143687743-143687765 GCTTAAGGGAGTCATGTGGCTGG + Intergenic
1202594163 Y:26519862-26519884 GCTTAAGGGAATGCTGTGGCTGG - Intergenic