ID: 1051753973

View in Genome Browser
Species Human (GRCh38)
Location 9:20375308-20375330
Sequence GCAACTATTAACTTTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051753972_1051753973 -6 Left 1051753972 9:20375291-20375313 CCAATGCTATTTGTACTGCAACT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1051753973 9:20375308-20375330 GCAACTATTAACTTTGAAAAAGG No data
1051753971_1051753973 15 Left 1051753971 9:20375270-20375292 CCGGATTTTCTGACTTCTAATCC 0: 1
1: 0
2: 10
3: 64
4: 514
Right 1051753973 9:20375308-20375330 GCAACTATTAACTTTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051753973 Original CRISPR GCAACTATTAACTTTGAAAA AGG Intronic
No off target data available for this crispr