ID: 1051754683

View in Genome Browser
Species Human (GRCh38)
Location 9:20385999-20386021
Sequence CTGTCTCACCAGAACCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051754683_1051754684 -6 Left 1051754683 9:20385999-20386021 CCACTCTGGTTCTGGTGAGACAG 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1051754684 9:20386016-20386038 AGACAGCCCTGTTGTCCCTTAGG No data
1051754683_1051754690 22 Left 1051754683 9:20385999-20386021 CCACTCTGGTTCTGGTGAGACAG 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1051754690 9:20386044-20386066 ACTGAATTCCCATTTCCAATGGG No data
1051754683_1051754689 21 Left 1051754683 9:20385999-20386021 CCACTCTGGTTCTGGTGAGACAG 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1051754689 9:20386043-20386065 AACTGAATTCCCATTTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051754683 Original CRISPR CTGTCTCACCAGAACCAGAG TGG (reversed) Intronic
900431828 1:2606356-2606378 CTGTCTCCCCAGGACTCGAGTGG - Exonic
902560258 1:17272958-17272980 CTTTTCCTCCAGAACCAGAGGGG + Intronic
903381019 1:22896878-22896900 GTGTCTCCCCAGCACCAGCGTGG + Intronic
904058997 1:27692512-27692534 ATGTCTTATCAGAATCAGAGGGG + Intergenic
904776445 1:32910942-32910964 TTGTATCACCACAACCAGACAGG + Intergenic
904966322 1:34377316-34377338 CTGCCTCACCAGAAACAGCCAGG - Intergenic
906907538 1:49911994-49912016 CTGTCACAGCAGATCCTGAGGGG + Intronic
907774650 1:57501990-57502012 CTGTCTCCGCAGTACCGGAGAGG + Intronic
907847164 1:58219441-58219463 CTGAATCACCAGGACCAGACTGG + Intronic
909283598 1:73788201-73788223 CTGCCTCACCAGATTCAGACAGG - Intergenic
911168283 1:94744633-94744655 CTGGCTCAGGAGAACCAGGGAGG + Intergenic
912569822 1:110613282-110613304 CTGTCACACCAGGTCCTGAGGGG + Intronic
916052827 1:161048222-161048244 CTGTTGGACCTGAACCAGAGTGG + Exonic
921627155 1:217389398-217389420 CTGTCTTACCAGTACTACAGGGG + Intergenic
1062789297 10:291305-291327 CTTTTTCACATGAACCAGAGAGG - Intronic
1065962726 10:30747141-30747163 CTATGCCACCAGAAACAGAGTGG - Intergenic
1067443259 10:46324784-46324806 CTGACTCTCCTGAACCAGAATGG - Intronic
1069249093 10:66245810-66245832 CAGTATGACCAGAACCTGAGAGG - Intronic
1073892987 10:108122276-108122298 CTCTCTCACCAGAAACAGTTAGG + Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1078002871 11:7512193-7512215 CTGGCTCACAAGAAGCAAAGTGG - Intergenic
1078928892 11:15898221-15898243 CAGTCACACCAGAGCCATAGGGG + Intergenic
1080492503 11:32781570-32781592 CTGCCTAACCAGAAAGAGAGAGG - Intronic
1081736554 11:45408540-45408562 CTGGCTCCCCAGCCCCAGAGTGG + Intergenic
1083624220 11:64063860-64063882 CTTTCTCCCCAGCCCCAGAGAGG + Intronic
1085469519 11:76748347-76748369 CCCTCTCACCAGAACCTGGGAGG - Intergenic
1088044569 11:105432461-105432483 ATGCCTCACCAGAAGCTGAGAGG + Intergenic
1090234804 11:125139454-125139476 CAGCCTCTCCAGAACCACAGCGG - Intergenic
1091409866 12:232319-232341 CTGCCCCTCCAGAACCACAGTGG + Intronic
1091934466 12:4424054-4424076 GTGTCCCACCAAAACCAGATGGG + Intergenic
1093178681 12:15943392-15943414 CTTTCGCACCACAGCCAGAGGGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094538946 12:31346994-31347016 CTGGCTCTCCAGATCCAGATTGG + Intergenic
1098788555 12:74790913-74790935 CTGTCTCAACAGAAAAACAGTGG + Intergenic
1098987427 12:77027789-77027811 CTGTGTCACCTGACCCAAAGTGG - Intronic
1101623615 12:106416654-106416676 CTGTCCCACCTCAACCAGAAAGG - Intronic
1102008908 12:109606309-109606331 CTCACTCCCCAGAGCCAGAGGGG - Intergenic
1104118237 12:125771492-125771514 AGGTCTCCCCAGAAACAGAGCGG - Intergenic
1104908564 12:132228523-132228545 CTGTCTCGCCAGAGGCAAAGAGG - Intronic
1107373990 13:39782479-39782501 CTGTCTGACCTGGACAAGAGGGG - Intronic
1108172450 13:47755776-47755798 CTGGGTCACCAGAACTAGAGTGG + Intergenic
1111479028 13:88797474-88797496 CTCTGTCACCAATACCAGAGAGG - Intergenic
1112980402 13:105377554-105377576 CTGTCTGATCACTACCAGAGAGG - Intergenic
1113375651 13:109763038-109763060 CTTTCACACCATAAGCAGAGTGG + Intronic
1115251380 14:31351982-31352004 TTTTCTCACCAGTAGCAGAGTGG - Intronic
1116974829 14:51104630-51104652 CTGTCTCACCTGGCTCAGAGTGG - Intergenic
1118940533 14:70332335-70332357 CTGTCACAGCAGATCCTGAGGGG + Intronic
1119495745 14:75077307-75077329 CTTTCCCAACAGAACCTGAGAGG - Intronic
1122631034 14:103107888-103107910 CTGTTCCACCTGATCCAGAGTGG - Intronic
1124016481 15:25880701-25880723 CTGCCTCACCAGAAACAGAATGG + Intergenic
1125351243 15:38769630-38769652 CTGTCTCACCAGACCTAGGGTGG - Intergenic
1126438849 15:48665207-48665229 CTGTCTATCCAGAAACAGAAAGG + Intergenic
1130171128 15:81515568-81515590 CTGTCTCACCTGAACTCAAGAGG - Intergenic
1132548774 16:545656-545678 CAGCCTCACCAGCTCCAGAGAGG - Intronic
1132719098 16:1307277-1307299 CTGTCCCACCAAGACCAGCGGGG - Intergenic
1133148412 16:3807985-3808007 CTGTCTCACAAGAACCCCTGTGG - Intronic
1134173117 16:11984656-11984678 CTGTCTCAAAAGAAAAAGAGAGG - Intronic
1138461626 16:57151746-57151768 CTGGCTCCCCAAATCCAGAGGGG - Intergenic
1140216884 16:73015803-73015825 CTGTCTCCGCAGCACCTGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1142423635 16:89988787-89988809 CTGTCTCACCAACACCGAAGAGG - Intergenic
1146487158 17:33252430-33252452 CTGTGTCAACACATCCAGAGAGG - Intronic
1147625086 17:41895026-41895048 ATGTCTCAGCAGAACCCGGGGGG - Intronic
1147635727 17:41962718-41962740 CTGTGTCACTAGAAACAGTGTGG - Intronic
1148388745 17:47254725-47254747 CTGTGTCCCCAGTACCAAAGAGG - Intronic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1150689598 17:67353319-67353341 CTGTCTCAAAAGAAAGAGAGAGG - Intronic
1153619252 18:6961682-6961704 CTTTGTCACCAGAATCAGAATGG - Exonic
1155239271 18:23849364-23849386 CAGTCACTCAAGAACCAGAGGGG + Intronic
1155349080 18:24888441-24888463 TTGCCCCACCAGAAACAGAGAGG - Intergenic
1158139153 18:54238930-54238952 CAGTCTTACCAGAGACAGAGAGG + Intergenic
1158878912 18:61757503-61757525 CTGTCTCCCCACTACCAGATGGG + Intergenic
1162373008 19:10290135-10290157 CTGTCCACCCCGAACCAGAGCGG - Intronic
1164497590 19:28782155-28782177 CTGTCTCATCAGAATGACAGTGG - Intergenic
1164576246 19:29407053-29407075 TTGTCGCATCAGAACCAGAGGGG - Intergenic
1165822817 19:38687271-38687293 AGGTCTCAGTAGAACCAGAGGGG - Intronic
1166076106 19:40414691-40414713 CTGACTCACCAGACCCCGGGGGG + Intergenic
1166415037 19:42589172-42589194 CTGTCTCAGTAGAAACAGCGGGG - Intronic
1167015741 19:46839820-46839842 CTGACTCTCCAGGATCAGAGGGG - Intronic
1167081691 19:47280449-47280471 GTCTCTCACCTGAACCAGGGCGG - Intergenic
1167508025 19:49881364-49881386 CTGGGTCACCAGAACCAGGTAGG - Exonic
1167886306 19:52502730-52502752 CTGTCTCAAAAGAAAAAGAGAGG + Intronic
925292320 2:2756015-2756037 CTGCATCACCCCAACCAGAGAGG + Intergenic
925831295 2:7898407-7898429 CAGTCTCACCAATATCAGAGTGG - Intergenic
927446953 2:23171655-23171677 CTGTCTGACCAGTCCCAGTGAGG - Intergenic
928698836 2:33878293-33878315 TTGTCAAACCAGAATCAGAGTGG - Intergenic
930100133 2:47596929-47596951 CTGCCTCATCCAAACCAGAGGGG - Intergenic
931249143 2:60514990-60515012 CTGTCTCACCAGAGGGAGAACGG - Intronic
932585052 2:73022485-73022507 CAGGCTGACCAGAACCAGAAGGG + Intronic
936028623 2:109053681-109053703 CTGTCTCACCAGAATCAGACAGG + Intergenic
938675867 2:133633298-133633320 CTCTCTCACCAAACCCAGAACGG + Intergenic
938737667 2:134201201-134201223 CTGTCTCAACTAAACCAAAGCGG - Intronic
939479924 2:142734981-142735003 CTGACTCACCAGAAGTACAGAGG + Intergenic
944006105 2:194908456-194908478 CTGTTTCAAGAGCACCAGAGTGG + Intergenic
944286090 2:197951376-197951398 CTGTCTTACCAGGGCCACAGTGG + Intronic
946735722 2:222752498-222752520 CTGTCTCGACAGAACCTCAGAGG - Intergenic
946772180 2:223100123-223100145 CTGTGTGTCCAGAGCCAGAGCGG - Intronic
947821301 2:233072964-233072986 CTGTGTCACCAGAACCTGGCAGG + Intronic
948468924 2:238165152-238165174 CTGTCTCCCCACACCCAGAAGGG + Intronic
1174866658 20:54143017-54143039 CTGTCTCACCAGAGCCAGTGAGG + Intergenic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1177193681 21:17880111-17880133 CTGTCACTCCAGGACCACAGCGG - Intergenic
1179046843 21:37852301-37852323 ATGTCTCCCCAGAGCCACAGGGG + Intronic
1179479579 21:41668924-41668946 CTGGCTCAGCAGACCCACAGGGG - Intergenic
1181339750 22:22168413-22168435 CTGTGGCTCCAGCACCAGAGTGG + Intergenic
1183305490 22:37080767-37080789 CTGTCCCACCAGTTCCAGAGCGG - Intronic
949095165 3:77187-77209 CTCTCTCAGCAGAGCAAGAGGGG + Intergenic
950679594 3:14575788-14575810 CTGTCTCCCCAGAGCTTGAGGGG + Intergenic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
955112124 3:55959693-55959715 CTGGCTCACCAGACCTAGATGGG - Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
963208986 3:142667598-142667620 ATGTCACACCAAAACCACAGAGG + Intronic
963476904 3:145818147-145818169 CAGTCTCAACTGAACCAGAAAGG - Intergenic
965830842 3:172787355-172787377 CTGTCTCAAGAGAATGAGAGAGG - Intronic
965883417 3:173414211-173414233 CTGACTTAACAGAAACAGAGAGG + Intronic
968660152 4:1795452-1795474 CTGTTTCACCAGCTCCAGTGCGG - Intronic
968948145 4:3676303-3676325 CTCTCTCGCCAGAACCTAAGGGG - Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
969177421 4:5409234-5409256 CTGTATCACAAGAGCCAGAAGGG - Intronic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
978189103 4:105893107-105893129 ATGTCTCACGGGACCCAGAGTGG + Intronic
979173886 4:117637620-117637642 CCAGCTCACCTGAACCAGAGAGG - Intergenic
979421301 4:120508915-120508937 CTGTCTAACCAGTCCCAGTGAGG - Intergenic
979752350 4:124294768-124294790 CTGGCCCACCTGAATCAGAGAGG - Intergenic
981301620 4:143193042-143193064 CTGTCAGAGCAGAACCAGACAGG - Intronic
984852901 4:184169184-184169206 CCCTCTCCCCAGAGCCAGAGAGG - Intronic
985888316 5:2697185-2697207 CTTTCTCACCAGCACCCGCGGGG + Intergenic
988269981 5:29001812-29001834 CTGGCTACCAAGAACCAGAGTGG - Intergenic
990864587 5:60366963-60366985 GTGTCACACCAGACCAAGAGAGG + Intronic
991004024 5:61810275-61810297 ATCCCTCACCAGAAGCAGAGGGG + Intergenic
991481491 5:67085840-67085862 CTATCTCACCAGACCCAGACAGG - Intronic
992092683 5:73332736-73332758 TTGTCACACAAGAACCAGAAAGG - Intergenic
992382844 5:76255750-76255772 GTGGCTCAGCAGAACCTGAGGGG - Intronic
992859021 5:80893007-80893029 CTATCTCACCTGAACCATAAGGG - Intergenic
998805535 5:145914759-145914781 CCTTCTCACCAGCAGCAGAGTGG + Intergenic
999196497 5:149784972-149784994 CTGTCTCTCCAGCACAAGATAGG + Intronic
1000229637 5:159303448-159303470 AGGCCTCACCAGAAGCAGAGCGG - Intergenic
1002684264 5:180995610-180995632 CTCTCTCACAAGAAACAGTGAGG - Intronic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1007097893 6:39225527-39225549 CTGTCCCACCAAAAACAGTGGGG - Intronic
1008469275 6:51865084-51865106 CTGTCTCACCAGGAACACTGAGG + Intronic
1008646224 6:53517626-53517648 CTTGCTCACCAGAATCAGATTGG + Intronic
1008835672 6:55824803-55824825 CTGTCTAACAAGACCAAGAGGGG + Intronic
1015281991 6:131443636-131443658 CTGTCTCTCCAGGAGGAGAGTGG - Intergenic
1017494318 6:154969988-154970010 CAGTCTCTCCACAGCCAGAGAGG - Intronic
1020676631 7:11191939-11191961 CTGTCTCTCTAGTACCAGTGGGG - Intergenic
1022821538 7:33966712-33966734 CTGTGTCACCATAACGAGACAGG + Intronic
1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG + Intronic
1027969895 7:85066192-85066214 CTGTTTCACCAGAGACAGAAAGG + Intronic
1031505631 7:122578551-122578573 CTGACTCAGCAGATCTAGAGTGG + Intronic
1039518623 8:38153086-38153108 CTGTCTCCCCAACACCAGACAGG + Intergenic
1039778512 8:40760474-40760496 CACCCTCACCAGAACCAGATTGG + Intronic
1041380810 8:57252849-57252871 CTTTCACACCAGAACAAGAAAGG + Intergenic
1041394721 8:57378700-57378722 ATGGCTCACCAGAACCACATGGG - Intergenic
1041794732 8:61735474-61735496 CTGTCTTACCACTGCCAGAGAGG + Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042454498 8:68984823-68984845 CTGTCTCGCCAGGACAAGATTGG + Intergenic
1044387602 8:91607929-91607951 ATGTCTCAGCAGAACCAGGCAGG - Intergenic
1046699423 8:117383306-117383328 CTGTCATACCAGAACCATGGGGG - Intergenic
1047271207 8:123360987-123361009 CTGTTTGACCAGAACCACTGTGG + Intronic
1048281555 8:133109276-133109298 CTGACTCAGCAGGTCCAGAGTGG - Intronic
1048569621 8:135640712-135640734 CTCTCTCAACAGATCAAGAGGGG - Intronic
1051695902 9:19767635-19767657 CTGTCTAACCAGTCCCAGTGAGG + Intronic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1051989072 9:23129392-23129414 CTATCTTACCAGAGCCTGAGAGG - Intergenic
1053303757 9:36969608-36969630 CAGTCTCCCCAGAAGCAGACTGG + Intronic
1054696885 9:68369459-68369481 CTGACTCACTAGAACAAGAAAGG - Intronic
1056798108 9:89673179-89673201 CTGACTGCCCAGAAGCAGAGGGG + Intergenic
1056861474 9:90188003-90188025 TTTTCTCACCAAAATCAGAGCGG + Intergenic
1057997788 9:99835428-99835450 CACTCTCACTGGAACCAGAGAGG - Intronic
1062010274 9:134263391-134263413 TGGTGTCACCCGAACCAGAGGGG - Intergenic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1186925147 X:14325580-14325602 CTGTCTACCCAGAATTAGAGAGG + Intergenic
1188609747 X:32081153-32081175 ATGTCTCACCATAACCAGAAAGG - Intronic
1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG + Intergenic
1197795038 X:130289504-130289526 CTCTCTCACAAGGACCAGAATGG - Intergenic
1198209330 X:134502027-134502049 ATGTCTTATCAGAACCAGGGAGG + Intronic
1198825807 X:140696697-140696719 TAGGCTCACCAGAACCAGGGAGG + Intergenic