ID: 1051756498

View in Genome Browser
Species Human (GRCh38)
Location 9:20406570-20406592
Sequence AGTGCTTAGAATCACGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051756498_1051756502 -6 Left 1051756498 9:20406570-20406592 CCAGTACCGTGATTCTAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1051756502 9:20406587-20406609 AGCACTGAGGTCTCAAACCAGGG No data
1051756498_1051756501 -7 Left 1051756498 9:20406570-20406592 CCAGTACCGTGATTCTAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1051756501 9:20406586-20406608 AAGCACTGAGGTCTCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051756498 Original CRISPR AGTGCTTAGAATCACGGTAC TGG (reversed) Intronic
905961435 1:42045739-42045761 AGCGCTTGGAATCAAGGTATGGG - Intergenic
906320091 1:44810332-44810354 AGTGCTTAGCACCACAGGACTGG - Exonic
907097286 1:51793285-51793307 ACTGCTTACAACCCCGGTACAGG - Intronic
908251562 1:62270004-62270026 AAGGCTGAGAATCACTGTACTGG + Intronic
1065256280 10:23871936-23871958 AGTGCTTAGAGACACGATTCAGG - Intronic
1071385230 10:85112959-85112981 AGTGCTTAGGACCAAAGTACAGG - Intergenic
1081372106 11:42316660-42316682 ACTACTCAGAATGACGGTACAGG - Intergenic
1093629744 12:21394704-21394726 AGTGCTTAGAATGCTGGTCCTGG + Intronic
1102789589 12:115633690-115633712 AGTGCTTAGAAACAGGGCAGAGG - Intergenic
1105205753 13:18222060-18222082 ACTTCTTAGTATCACAGTACGGG - Intergenic
1105909430 13:24848229-24848251 AGTGGTTAGAGTCCCGGTTCTGG - Intronic
1153584565 18:6607910-6607932 AGTGCTTAGAATCACGGAGGAGG + Intergenic
1166960962 19:46495565-46495587 AGGGCTTAGAGTCCCGGTTCCGG + Exonic
931176108 2:59856744-59856766 AGTGGTTAGCAGCTCGGTACAGG - Intergenic
936058880 2:109281676-109281698 AGTTCTTAGATTCAGGGTAGAGG + Intronic
937001529 2:118472181-118472203 TGTGCTCAGAATTACGGAACCGG + Intergenic
1172899298 20:38322455-38322477 AGTGCTTAGAACCAGGGACCTGG - Intronic
1180760213 22:18196656-18196678 ACTTCTTAGTATCACAGTACAGG + Intergenic
1180770526 22:18380954-18380976 ACTTCTTAGTATCACAGTACAGG + Intergenic
1180775455 22:18428040-18428062 ACTTCTTAGTATCACAGTACAGG - Intergenic
1180808525 22:18739095-18739117 ACTTCTTAGTATCACAGTACAGG - Intergenic
1180828469 22:18883912-18883934 ACTTCTTAGTATCACAGTACAGG + Intergenic
1181071453 22:20344059-20344081 ACTTCTTAGTATCACAGTACAGG - Intergenic
1181214918 22:21319769-21319791 ACTTCTTAGTATCACAGTACAGG + Intergenic
1182090182 22:27589318-27589340 AGTACTTAGCATCACGCTAAGGG - Intergenic
1184422050 22:44387721-44387743 AGTGCTTAGAAGCAGGGACCCGG + Intergenic
1203232361 22_KI270731v1_random:122126-122148 ACTTCTTAGTATCACAGTACAGG + Intergenic
1203278566 22_KI270734v1_random:109901-109923 ACTTCTTAGTATCACAGTACAGG + Intergenic
954386165 3:50245296-50245318 CATGCTAAGAATCACGGCACTGG - Intronic
954453524 3:50584663-50584685 AGGGCTTAAAATCAAGGTATTGG - Exonic
963262457 3:143206505-143206527 ACTGCTTAGGATCATGGAACTGG + Intergenic
963964720 3:151353839-151353861 ACTACTTAGAATCACAGTGCTGG + Intronic
986643700 5:9895923-9895945 TGTGCTAATAATCACAGTACAGG - Intergenic
988037285 5:25843746-25843768 AGGGCTCAGAATCATGGTGCGGG + Intergenic
988126209 5:27041498-27041520 AGTAATTAGAATCATGGTCCTGG - Intronic
996353037 5:122566679-122566701 AGTGCTTAGAAGCACTGATCAGG + Intergenic
1002363407 5:178691884-178691906 AGAGCTTAGAATGATGGGACTGG - Intergenic
1003164735 6:3666205-3666227 TGTGCTTGGAATCACAGTACTGG + Intergenic
1006709132 6:36050254-36050276 AGTGATTATAATCATGGAACAGG + Intronic
1015286532 6:131491568-131491590 ACAGCTTATCATCACGGTACAGG - Intergenic
1026255467 7:68707509-68707531 AGTGCTTAAAAACACGGGAGAGG + Intergenic
1031915012 7:127554725-127554747 TGTGCTCAGAATCACAGTCCTGG + Intergenic
1032834086 7:135657646-135657668 AGTGCTTAGAATCACTGGTATGG + Intergenic
1034296668 7:149978933-149978955 AGTCCTCAGTCTCACGGTACTGG + Intergenic
1036637259 8:10559829-10559851 AGTGCTTAGAGTGAAGGTGCAGG + Intergenic
1045016647 8:98006561-98006583 AGTGCTTAGAATGCAGGTTCTGG - Intronic
1048860274 8:138719782-138719804 ACTGCTTAGATACACAGTACGGG - Intronic
1051756498 9:20406570-20406592 AGTGCTTAGAATCACGGTACTGG - Intronic
1057599348 9:96443672-96443694 AGTTCTTAGAATCACTCTAAAGG - Intergenic
1058454686 9:105128220-105128242 AGTGCTGTGAATCAGGCTACTGG + Intergenic
1058936039 9:109770441-109770463 AAAGCTTAGAATCACTGTTCTGG + Intronic