ID: 1051756502

View in Genome Browser
Species Human (GRCh38)
Location 9:20406587-20406609
Sequence AGCACTGAGGTCTCAAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051756498_1051756502 -6 Left 1051756498 9:20406570-20406592 CCAGTACCGTGATTCTAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1051756502 9:20406587-20406609 AGCACTGAGGTCTCAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051756502 Original CRISPR AGCACTGAGGTCTCAAACCA GGG Intronic
No off target data available for this crispr