ID: 1051757035

View in Genome Browser
Species Human (GRCh38)
Location 9:20412861-20412883
Sequence AACCTTACACTTCTAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051757035 Original CRISPR AACCTTACACTTCTAGTGAC AGG (reversed) Intronic
901279165 1:8019110-8019132 AATCTTACCCTTCCATTGACAGG + Intronic
903696208 1:25209263-25209285 AAACTTACCCTTCTAGGGGCCGG + Intergenic
910826773 1:91417427-91417449 AATCTTACACTTGGAATGACAGG - Intergenic
912938193 1:114021921-114021943 AGCCTTACATTCCTAGTGCCAGG + Intergenic
916268787 1:162918661-162918683 AGCCTTACATTCCTAGTGCCAGG - Intergenic
917663551 1:177201447-177201469 AATCTTTGACTTCCAGTGACAGG - Intronic
1064191177 10:13207418-13207440 CACCTTCCACCTCTAGAGACTGG - Intronic
1066507917 10:36064872-36064894 AACCTCACGCTGCTCGTGACAGG - Intergenic
1066714856 10:38276001-38276023 AAACTTACACTTGTGGTGAAAGG + Intergenic
1066783222 10:38974698-38974720 AAACTTACACTTGTGGTGAAAGG - Intergenic
1067167345 10:43875986-43876008 AACCTGACACTTTTAGTGTCAGG + Intergenic
1068243286 10:54333965-54333987 AACCTTACATTTCTAAAGCCAGG + Intronic
1068668941 10:59705206-59705228 TATCTTACACTTTCAGTGACGGG - Intronic
1070989431 10:80718488-80718510 AACCTCACACTTGTAGGGGCTGG + Intergenic
1072476127 10:95761531-95761553 AAGCTGCCACTTCTAGTCACTGG + Intronic
1072566452 10:96620604-96620626 AACCGTACACTTCTGGTGAGTGG - Intronic
1077290274 11:1786474-1786496 AACCTTACAATTCTGGAGGCCGG + Intergenic
1077866621 11:6227325-6227347 AACATTACCCAGCTAGTGACAGG + Intronic
1081561631 11:44222461-44222483 CCCCTTACAATTCTACTGACAGG - Intronic
1082008446 11:47434408-47434430 AAACTTACAGTTCTAGAGACAGG - Intergenic
1082834449 11:57641241-57641263 AACATTGCACTGCTAGTGACAGG - Intergenic
1088850000 11:113696634-113696656 AACCCTACATTTCTTGTGAAGGG + Intronic
1089727520 11:120495694-120495716 AAACCAACACTTCAAGTGACAGG + Intergenic
1090786204 11:130049674-130049696 ATTCTTAAACTTCTAGTTACTGG + Intergenic
1092927424 12:13284320-13284342 AACCTCAGACTTCAAGTGAAAGG - Intergenic
1094711635 12:32969445-32969467 TTGTTTACACTTCTAGTGACAGG + Intergenic
1095349646 12:41193396-41193418 AAGCTTTGACTTCTTGTGACTGG + Intronic
1102307060 12:111813079-111813101 CTCCTTGCACTTTTAGTGACAGG + Intergenic
1104083141 12:125449724-125449746 AATCTTTGACTTCTAGTGCCTGG - Intronic
1106374337 13:29170413-29170435 AACATTATGCTTCTAGTAACAGG + Intronic
1107447638 13:40482724-40482746 AAACTTACAATCCTGGTGACAGG + Intergenic
1110440704 13:75522180-75522202 AAACTTACAATTATAGTGAGAGG - Intergenic
1113583401 13:111445411-111445433 AACATTGCACTTATAGTGAATGG - Intergenic
1114205157 14:20564024-20564046 AGCCTTACATTCCTAGTGCCAGG + Intergenic
1123201415 14:106668896-106668918 AACCTTAAACTTTTGGTGATTGG - Intergenic
1126564997 15:50085567-50085589 ATCCATACACTTCTAGTGCCAGG - Intronic
1128169825 15:65501459-65501481 AAGGTTAGACTTCTAGTGAAGGG - Intronic
1132026272 15:98406801-98406823 AACCTTAGACTTCTAGCCCCAGG - Intergenic
1134313012 16:13093269-13093291 AACCCAACAGTTATAGTGACAGG - Intronic
1134330981 16:13251014-13251036 AACCTTACACTACTAGGTAAGGG - Intergenic
1152445202 17:80338610-80338632 AACCTTATACTTTTTGAGACAGG - Intronic
1157782461 18:50451868-50451890 AGCCTTACATTCCTAGTGCCGGG + Intergenic
1164288248 19:23841558-23841580 AACCTGACACTTGGCGTGACAGG - Intergenic
925459647 2:4049446-4049468 AGCCTTACATTTCTAGTGTCAGG + Intergenic
929587471 2:43125556-43125578 AACCCTACACATCTGGTGAAGGG + Intergenic
929944938 2:46363042-46363064 AAGATTGCACTTTTAGTGACAGG + Intronic
931298980 2:60958150-60958172 AACCTGACACTTGGCGTGACAGG + Intronic
932252514 2:70257400-70257422 AACCTTACAGTTCTCGCAACAGG + Intronic
934151011 2:89147557-89147579 AGCCTTACATTCCTAGTGCCAGG + Intergenic
934216262 2:90034466-90034488 AGCCTTACATTCCTAGTGCCAGG - Intergenic
936696402 2:114954530-114954552 AACATTACACCTCTAGGAACTGG + Intronic
940452237 2:153853808-153853830 GAACATACAGTTCTAGTGACAGG + Intergenic
942576254 2:177366444-177366466 ATGCTTGCACTTCTAGGGACAGG - Intronic
943955404 2:194182554-194182576 AACCTTTCAGATCTAGTGAGGGG - Intergenic
947704292 2:232261837-232261859 AAGGTTACACTGCTAGAGACTGG - Intronic
1170009695 20:11708707-11708729 ACCTTTATACTTCAAGTGACTGG + Intergenic
1177792461 21:25735449-25735471 GACCTCACACTTCTAGTCGCGGG + Intronic
1180064020 21:45404146-45404168 GACTTCACACTTCTAGTGCCCGG - Intergenic
1184952822 22:47856817-47856839 AACCTAACAATTCAAGTAACAGG + Intergenic
952207490 3:31194523-31194545 ATCTTTTCACTTCTTGTGACAGG + Intergenic
955551922 3:60094384-60094406 AAACTCACAGTTTTAGTGACAGG + Intronic
956304369 3:67808007-67808029 GAACTTACAATTCTAGTGCCTGG + Intergenic
957823486 3:85409782-85409804 CATCTTTCACATCTAGTGACAGG - Intronic
961578914 3:127861883-127861905 AACATTACACAGCTAGTGAAAGG + Intergenic
966074263 3:175918400-175918422 AAACTTACAGTTCCAATGACTGG + Intergenic
971509870 4:27411015-27411037 CACCTTCCAGTTCAAGTGACTGG + Intergenic
971787046 4:31117881-31117903 AACATTTCATTTCTATTGACAGG + Intronic
973083220 4:46021816-46021838 AACCTACTACTTCTTGTGACTGG - Intergenic
974653782 4:64791192-64791214 AACTGTACACATCTATTGACTGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
980479730 4:133373105-133373127 AATCTTTCATTTCTAGTGTCTGG - Intergenic
992154808 5:73944777-73944799 AATCTTACAGTTCTAGAGGCTGG - Intergenic
996816356 5:127577459-127577481 AACCTTACACTTCAAGTTACTGG + Intergenic
1000915939 5:167081784-167081806 AACCTTACACGGCTAGTGAATGG + Intergenic
1002375603 5:178786878-178786900 ATCCTTGCACTTCTAATGGCTGG + Intergenic
1006178754 6:32140658-32140680 AGCCTTACATTCCTAGTGCCAGG - Intergenic
1016691084 6:146938625-146938647 ACTCTTAAACTTCTAGTGAGAGG + Intergenic
1017437021 6:154425275-154425297 AAGATTACACATCTAGAGACAGG - Intronic
1017782567 6:157727625-157727647 AGCCTTACACTCCTCGTGCCAGG - Intronic
1020778052 7:12481346-12481368 AATCTGTCAATTCTAGTGACTGG + Intergenic
1024402000 7:48935110-48935132 AACATAACACTTCCAGGGACTGG + Intergenic
1031063861 7:117082957-117082979 TACCATACATATCTAGTGACAGG + Intronic
1034043334 7:147902066-147902088 CACCATACAATTCTCGTGACTGG - Intronic
1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG + Intronic
1043540707 8:81259057-81259079 AACATTACACATCTAGTAACTGG - Intergenic
1044052033 8:87516782-87516804 CACCTGACATTTCTAGTGAGTGG + Intronic
1048100316 8:131343660-131343682 ATCCATACAGTCCTAGTGACTGG - Intergenic
1051757035 9:20412861-20412883 AACCTTACACTTCTAGTGACAGG - Intronic
1055370344 9:75591811-75591833 GGGCTTCCACTTCTAGTGACTGG - Intergenic
1056630793 9:88291305-88291327 CACCTTACAGTCCAAGTGACAGG + Intergenic
1058408990 9:104709496-104709518 ATCCTTACACTTCAAGAGGCAGG - Intergenic
1059598054 9:115744483-115744505 CACCTGACACTTCTAGTGCGTGG + Intergenic
1059622137 9:116018561-116018583 AACATTACACCTCAAGGGACTGG - Intergenic
1188605999 X:32030552-32030574 AATCTTACACTTCAAGTAATGGG + Intronic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1193500791 X:82271727-82271749 AACCTTTTGCTTCTAGAGACAGG - Intergenic
1199167840 X:144698571-144698593 AAACTTACATTTTTAGTGAGAGG - Intergenic
1201613908 Y:15874304-15874326 TACCTTACAGTTCTGGAGACTGG - Intergenic