ID: 1051763945

View in Genome Browser
Species Human (GRCh38)
Location 9:20501449-20501471
Sequence GACTCAGTTAAAACCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051763940_1051763945 5 Left 1051763940 9:20501421-20501443 CCAAAGGAGCCCTCATTAAGACC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG No data
1051763942_1051763945 -4 Left 1051763942 9:20501430-20501452 CCCTCATTAAGACCTAGGAGACT 0: 1
1: 0
2: 0
3: 16
4: 286
Right 1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG No data
1051763943_1051763945 -5 Left 1051763943 9:20501431-20501453 CCTCATTAAGACCTAGGAGACTC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG No data
1051763938_1051763945 27 Left 1051763938 9:20501399-20501421 CCATGATTATTACTTACAATATC 0: 1
1: 0
2: 3
3: 51
4: 529
Right 1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051763945 Original CRISPR GACTCAGTTAAAACCACACC CGG Intronic
No off target data available for this crispr