ID: 1051767777

View in Genome Browser
Species Human (GRCh38)
Location 9:20543392-20543414
Sequence TCTTACATGGGTATGGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051767773_1051767777 3 Left 1051767773 9:20543366-20543388 CCTTTCACTGGAATACACAGTTC 0: 1
1: 0
2: 4
3: 11
4: 233
Right 1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051767777 Original CRISPR TCTTACATGGGTATGGCTTA TGG Intronic
No off target data available for this crispr