ID: 1051779864

View in Genome Browser
Species Human (GRCh38)
Location 9:20678578-20678600
Sequence GGCCTCCTGCAGCACTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051779864_1051779871 29 Left 1051779864 9:20678578-20678600 CCTTCACAGTGCTGCAGGAGGCC 0: 1
1: 0
2: 5
3: 27
4: 290
Right 1051779871 9:20678630-20678652 GCTTCAGGAGATCAAGAGAGAGG No data
1051779864_1051779868 14 Left 1051779864 9:20678578-20678600 CCTTCACAGTGCTGCAGGAGGCC 0: 1
1: 0
2: 5
3: 27
4: 290
Right 1051779868 9:20678615-20678637 GCACAGGCTTCCCTTGCTTCAGG No data
1051779864_1051779866 -2 Left 1051779864 9:20678578-20678600 CCTTCACAGTGCTGCAGGAGGCC 0: 1
1: 0
2: 5
3: 27
4: 290
Right 1051779866 9:20678599-20678621 CCGACCTATAACTGCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051779864 Original CRISPR GGCCTCCTGCAGCACTGTGA AGG (reversed) Intronic
900130866 1:1086612-1086634 GGCCTCCTGTGGCTCTGTGCTGG - Intronic
900616276 1:3567068-3567090 GGCCTGCTGCTGCCCTGTGGTGG + Intronic
901443242 1:9292407-9292429 AGCCTCCTGCAGCGCTGTTTCGG - Intergenic
902275492 1:15336766-15336788 GGCCCCCTGCAGCACTGACTAGG + Intronic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
905635143 1:39545987-39546009 TGCCTTCTGCAGCCCTGTCAGGG - Intergenic
905663307 1:39745217-39745239 TGCCTCCTGCAGCCCTATCAGGG + Intronic
908256226 1:62305705-62305727 ACCCTCCTGCAACACGGTGAAGG + Intronic
909056467 1:70826631-70826653 GGCCTCCTGCAGGAGTCAGAAGG + Intergenic
913010157 1:114675427-114675449 GGCCTCATGCATTACTGTGATGG - Intronic
914025120 1:143905679-143905701 GGCCTCCTGCAGCGCCATCACGG + Exonic
914437068 1:147669938-147669960 GGCCTCCTGCAGCTCGGCCAGGG + Exonic
914663556 1:149813394-149813416 GGCCTCCTGCAGCGCCATCACGG + Exonic
914667079 1:149840870-149840892 GGCCTCCTGCAGCGCCATCACGG + Exonic
914668688 1:149852920-149852942 GGCCTCCTGCAGCGCCATCACGG - Exonic
914830075 1:151164918-151164940 GGACTTGTGCAACACTGTGATGG + Intronic
915828195 1:159101293-159101315 TCTCTCCTGCTGCACTGTGAAGG + Intronic
916563969 1:165957210-165957232 GGCTTCCTGCTGACCTGTGATGG - Intergenic
917104656 1:171480295-171480317 TTCTTCCTGCAGCTCTGTGAGGG + Intergenic
918696433 1:187551341-187551363 AGCCTGCCGCAGCACTGTGGAGG - Intergenic
923232192 1:231997515-231997537 GGCCTTCCTCAGCAATGTGAAGG - Intronic
923248858 1:232160892-232160914 GGCCTCTTGCAGGACTGGGATGG + Intergenic
924432299 1:244007508-244007530 GACCACCTGCATGACTGTGAGGG + Intergenic
1063105518 10:2988429-2988451 AACCTACTGCAGCACTGGGAAGG - Intergenic
1063809726 10:9691286-9691308 GCCCTCCTCCAGCCCTGTGCAGG + Intergenic
1069663626 10:70140050-70140072 GGCCGGCTGGAGCACCGTGATGG + Exonic
1070098795 10:73365525-73365547 GGCCTCCTGAAGTGCTGGGATGG + Intergenic
1071689094 10:87796600-87796622 GACCTCCTGCAGCTGTGTCATGG + Intronic
1073187414 10:101624968-101624990 GACATCTTGGAGCACTGTGAGGG + Intronic
1073242789 10:102069130-102069152 GGCCTCCTCCAGAACTTGGATGG + Intergenic
1074096808 10:110320481-110320503 GGCCTCAGTCAGCTCTGTGATGG + Intergenic
1076231173 10:128821159-128821181 GGCCTCCTGCAGCCCTGGGATGG - Intergenic
1076312996 10:129521576-129521598 GGACTCCTGCAGGACTGAGGTGG - Intronic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1077120028 11:902928-902950 GACCTCCCTCTGCACTGTGAGGG + Intronic
1077201181 11:1308520-1308542 GGCCTCCTGGCTCACTGTTAGGG - Intronic
1077306973 11:1872873-1872895 GCCCTCATGCAGCACTGGGTGGG + Intronic
1077490465 11:2858613-2858635 GGCCTCCTGCAGCCCAGAGTGGG + Intergenic
1078894404 11:15585102-15585124 GGCCTGTTGAAGCACAGTGAGGG - Intergenic
1082678355 11:56137963-56137985 AGCATCCTGCAACACTTTGAGGG + Intergenic
1083258526 11:61510664-61510686 GGCCTCCTGCACCGCAGAGAGGG + Exonic
1083776882 11:64898336-64898358 GGCCACATGCAGCGCTTTGATGG + Exonic
1083799393 11:65037817-65037839 GGCCTCCTGCAGGAGGGAGAAGG - Intronic
1084091043 11:66879570-66879592 GGCCTCCAGCAGCCTTGTGTTGG - Intronic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1084840731 11:71844057-71844079 AGCCTGCCGCTGCACTGTGAGGG - Intergenic
1085315774 11:75543973-75543995 GGCCTCATGCTGCAGTGTGTTGG - Intergenic
1085390726 11:76180824-76180846 GTCTTCCTGCAGGCCTGTGATGG - Intergenic
1088151439 11:106750096-106750118 GGCCTTCTGCAGCAGACTGAAGG - Intronic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1090236123 11:125148674-125148696 GGCCTGCTGCAGAGCTGGGAGGG - Intergenic
1090964306 11:131584873-131584895 GGCCCGATGCAGCACTGAGAGGG - Intronic
1091204513 11:133810485-133810507 GGCCTCTTCCTGCACTGAGAAGG + Intergenic
1091590330 12:1838946-1838968 AGCCACCTGCAGCACTTGGAAGG - Intronic
1091613995 12:2035215-2035237 GGCCTCCTTCAGGACTTGGAAGG - Intronic
1091705222 12:2688910-2688932 GCCCTCCTGCAGCCCTGAGAGGG - Intronic
1092264039 12:6967766-6967788 GGCCTCCTGCTGGGCTGTGGTGG + Exonic
1092728853 12:11509604-11509626 GTCCTCCTGCAGTAGTGAGAGGG - Intergenic
1096106320 12:48998594-48998616 CGCCTCCTGCAGCACCCTGGAGG + Exonic
1096238478 12:49945713-49945735 CCCCTGCTGGAGCACTGTGATGG - Intergenic
1096724829 12:53553142-53553164 CGCCTGCTGCAGCACTGTAGGGG - Intronic
1097951441 12:65433600-65433622 ACCCTCCTGCTTCACTGTGATGG + Intronic
1099170103 12:79353765-79353787 GGCTTCCTGGGGCACTGTGTTGG - Intronic
1102011548 12:109622229-109622251 TGCCTCCTGCAGCTCGGGGAGGG + Intergenic
1102844813 12:116168972-116168994 GGCCTACTGCAGGGGTGTGAAGG + Intronic
1103727407 12:123004965-123004987 GGGCTCCTGCAGCGCGGTGGAGG - Intronic
1104632835 12:130418888-130418910 GGCCTCAGGCAGCTCTGTGTTGG - Intronic
1105024101 12:132837295-132837317 TGCCTGGTGCAGCACTGTGCTGG + Intronic
1105600058 13:21878724-21878746 GGCCATCTGCAGCCCTGTGCCGG + Intergenic
1105997288 13:25685107-25685129 GGCCTCCTCCATCTCTATGAAGG + Intronic
1106168672 13:27270815-27270837 GGCTGCCTGCAGAACTGTCAAGG - Exonic
1106407669 13:29487964-29487986 GTCATCCTGCAGGATTGTGATGG - Exonic
1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG + Intronic
1107976450 13:45693129-45693151 GGCCTCCTGGAGGACTCTGTGGG + Intergenic
1108650591 13:52475092-52475114 GCCCTAATGCAGCACTGTGCCGG + Exonic
1112621602 13:101058975-101058997 GGCCTCCTGGAGCACCCTGCTGG + Intronic
1113670246 13:112171169-112171191 GGCCTCCTGCACCTATGTGCTGG - Intergenic
1113715952 13:112508052-112508074 GGCCCCAGGCAGCACTGGGATGG - Intronic
1113857592 13:113456535-113456557 GCCCCCCTGCAGCACTGTGCAGG - Intronic
1114526913 14:23372247-23372269 GTCTTCCAGCAGCCCTGTGAGGG + Intergenic
1114725761 14:24934991-24935013 GGTCTCCTGGAGCAATGGGATGG + Intronic
1116446818 14:45020965-45020987 GGCCTCATGGAGCCCAGTGAGGG + Intronic
1117416547 14:55501681-55501703 GGCCTCCTGAAGCTGTGTCATGG + Intergenic
1119284645 14:73443114-73443136 GGCCTCCCAAAGCACTGTGCTGG + Intronic
1120015376 14:79467318-79467340 GGGCTTCAGCACCACTGTGAAGG + Exonic
1121105663 14:91277972-91277994 GGCCTCCCCCAGCAGTGAGATGG - Exonic
1122679635 14:103448212-103448234 GCTCTCTTGGAGCACTGTGAAGG - Intronic
1123625379 15:22223486-22223508 GGCCTCCTGAAGCCCTTGGATGG + Intergenic
1124340750 15:28887782-28887804 GGGCTCTAGCAGCACTGTCAGGG + Intronic
1124363163 15:29053732-29053754 GTCCTCCCGCAGCCATGTGAGGG - Intronic
1125362267 15:38876606-38876628 GGCATCCAGCAGAACTGTGCTGG - Intergenic
1127282624 15:57504873-57504895 GGCCCCATGAATCACTGTGAGGG - Intronic
1128944048 15:71809675-71809697 GGTCTCCTTCAGGCCTGTGAGGG - Intronic
1129177016 15:73847576-73847598 TCTCTCCTGCAGCAATGTGAAGG + Intergenic
1129331933 15:74832275-74832297 GGTCTCCTCCAGCTCTGAGAAGG - Intergenic
1129462323 15:75705668-75705690 GGCCTCCTGCTTCCCTGTGTGGG + Intronic
1129722532 15:77886173-77886195 GGCCTCCTGCTTCCCTGTGTGGG - Intergenic
1131178271 15:90223650-90223672 GACATCCTGCAGCACGTTGAAGG - Exonic
1131387745 15:92021194-92021216 GGCCTTCTGCTGCACTATCAAGG - Intronic
1132522378 16:397613-397635 GGCCGGCTGCAGCACTGGGCGGG + Intronic
1133781499 16:8942412-8942434 GCTGTTCTGCAGCACTGTGAGGG + Intronic
1133838086 16:9384126-9384148 CTTCTCCTTCAGCACTGTGACGG + Intergenic
1134247888 16:12553508-12553530 TCCCTCCTCCAGCACTGTGATGG - Intronic
1134270517 16:12729079-12729101 GGCTTCCTCCAGCACAGAGATGG - Intronic
1135222147 16:20622757-20622779 GGACTCCTGCAGCCCTGCCATGG - Intronic
1135591701 16:23709921-23709943 GGCCTTCTCCAGGACTCTGAGGG - Intronic
1136469839 16:30472843-30472865 GGATTCCTGCATCACTGTGATGG + Exonic
1136496738 16:30649825-30649847 GGCTTCTTGCAGCGCTATGAAGG - Intergenic
1138066527 16:53947130-53947152 GCCTTGCTGCTGCACTGTGAAGG + Intronic
1138828931 16:60355451-60355473 TGCCTCCTGCAGCAAGCTGATGG - Intergenic
1139537569 16:67587214-67587236 GGCCTCCTGCAGTGCTGGAATGG + Intronic
1139675348 16:68519632-68519654 GGCCTCGTGCATCTGTGTGATGG - Intergenic
1139748527 16:69094027-69094049 AGCCTCCTGCAGCTCTGTGCTGG - Intergenic
1140626164 16:76796864-76796886 GCCTTCCTGCAGTACTATGATGG - Intergenic
1141885888 16:86891936-86891958 GGCCTCCTGAAGCATTAGGATGG - Intergenic
1141939260 16:87263761-87263783 GGCCCACTGCAGAACTGTGAAGG + Intronic
1143250999 17:5522930-5522952 CTCCTCCTCCAGCACTGTGTGGG + Intronic
1143408715 17:6695866-6695888 CTCCTCCTGCAGCACCTTGAGGG + Exonic
1143517519 17:7427199-7427221 GGCCTCGTCCAACACCGTGAGGG - Exonic
1144721995 17:17477320-17477342 GGCCTCTTGCAGCTCTGAAACGG - Intronic
1144733772 17:17543410-17543432 GAGCTCCTGCGGCACTGGGAAGG + Intronic
1145250839 17:21296184-21296206 TTCGTCCTGCAGCACTGTGCGGG + Intronic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1146845748 17:36181155-36181177 GGGCTCATGCAGTAATGTGAGGG + Intronic
1147019412 17:37519400-37519422 GGCTTCCTTCAGCACAGTGAGGG - Intronic
1147660622 17:42115154-42115176 CTCCTCCTGGGGCACTGTGAGGG + Intronic
1147945096 17:44076282-44076304 GGGTTCTTGCAACACTGTGAGGG + Exonic
1148145461 17:45361816-45361838 GGGCTTCTGGGGCACTGTGAGGG - Intergenic
1149681750 17:58512480-58512502 CTCACCCTGCAGCACTGTGAAGG + Exonic
1150301797 17:64053309-64053331 GGTCTGCTGCAGCAAGGTGATGG + Exonic
1151917336 17:77127968-77127990 TCCCTCCTGCAGCTCTGGGAAGG - Intronic
1152268913 17:79312445-79312467 GGCCACCAGATGCACTGTGAGGG + Intronic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1154346027 18:13544245-13544267 GGCCCACTGCAGCACTCTGACGG - Intronic
1155643280 18:28046016-28046038 GGCATCCTGCACAACTCTGATGG - Intronic
1156298935 18:35818278-35818300 GGCCTCCTGCAACACGGAGTGGG - Intergenic
1157377001 18:47176203-47176225 CTCCTCGTGCAGCACTGCGATGG + Exonic
1157809363 18:50683773-50683795 GTTCTCCTGCAGCTCTGGGAGGG - Intronic
1158905133 18:62004305-62004327 GCCCTCCTGAAGCACTGGGGTGG - Intergenic
1159493932 18:69176056-69176078 GGCCCAGGGCAGCACTGTGAAGG - Intergenic
1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG + Intronic
1161589183 19:5121116-5121138 TGCCTCCTGGAGTACTGCGAGGG - Intronic
1161737556 19:6000966-6000988 TGCCTCCTGCAGTTCTGTCAAGG - Intronic
1162463870 19:10829586-10829608 AGCCTCCTGGAGCACAGAGAAGG + Intronic
1163132813 19:15286273-15286295 GTCTTGCTGCAGCACTGTGTTGG - Intronic
1163413742 19:17172904-17172926 GGCCTCCCGAAGCACTGCCATGG - Exonic
1163483427 19:17572396-17572418 GGCCTCCTGAAGCCGTGGGATGG + Intronic
1163598245 19:18232909-18232931 GGCCTCCTGCAGCGCGGGGGAGG - Intronic
1164460196 19:28440398-28440420 GGCAGCCTGCAGCCCTGTGGTGG - Intergenic
1164466879 19:28494632-28494654 GGCCGGCAGCAGCACTGTCAAGG - Intergenic
1166334767 19:42099150-42099172 GGCCTCTTCCAGCACTGCAACGG - Intronic
1167030620 19:46957357-46957379 GGCCTCCAGAAGCACTGGGATGG - Intronic
1167716367 19:51144872-51144894 GGAGACCTGCATCACTGTGAGGG - Intronic
1167724610 19:51201600-51201622 GGCCTCCTTTAGCAGTGTGAGGG - Intergenic
1168682969 19:58329300-58329322 GGCCTCCTGCATCTCTGTCCAGG + Intronic
927004630 2:18835276-18835298 TGCCGTCTTCAGCACTGTGAAGG + Intergenic
927212397 2:20646842-20646864 CGCCTCCTGCAACCCTGCGAAGG + Intronic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
928047745 2:27954356-27954378 GGAGTGCAGCAGCACTGTGAGGG + Intronic
928101275 2:28438872-28438894 GGCCACCTGCTGCCCTGTGAAGG - Intergenic
932376820 2:71243785-71243807 GGGCTCCTGCAGCCCTGGAAAGG - Intergenic
933474066 2:82766450-82766472 GGCCTGCCCCAGCACTGTGTTGG + Intergenic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
936252057 2:110874600-110874622 GGCCTCCTTCAGCACAGGGGAGG + Intronic
937106946 2:119324728-119324750 CCCCTCCTGCAGCACTGAGAAGG + Intronic
942801569 2:179882135-179882157 GACCTCCTGCAGCTGTTTGATGG - Intergenic
947103735 2:226647924-226647946 AGCCTGCTGCTGCACTGTGGGGG + Intergenic
947153381 2:227136525-227136547 AGCCTCCAGCAGTACAGTGATGG + Intronic
947376876 2:229505003-229505025 TGCCTTCAGCAGTACTGTGAAGG + Intronic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
947851812 2:233294403-233294425 GGGCTCCTGCAGCCCTGTCCTGG + Exonic
948488079 2:238293975-238293997 GGGCTCCTTCAGGACAGTGAGGG - Intergenic
948575561 2:238947296-238947318 GGCCTCCTGCTCCACTGAGTAGG - Intergenic
948587302 2:239027512-239027534 GTCCTCATGCAGCACTGCCAAGG - Intergenic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1172215588 20:33233416-33233438 GGCCTGATACAGGACTGTGAGGG - Intergenic
1172393584 20:34583344-34583366 AGCCTCCTGCAGCACTGCACAGG + Intronic
1173191260 20:40877565-40877587 CGCCTCTTCCAGCAATGTGAGGG - Intergenic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1173555314 20:43961597-43961619 GGCCTCCAGCTGCACTGTGGCGG + Intronic
1174657294 20:52182261-52182283 GGCTCCCTTCAGCACTGTGCAGG + Intronic
1174734396 20:52951566-52951588 GGACTTCTGAAGCACTTTGATGG - Intergenic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1175179187 20:57133140-57133162 GGCTTCCTGGAGCATTTTGATGG - Intergenic
1176412520 21:6456880-6456902 GAGATCCTGCAGCAGTGTGATGG - Intergenic
1176663769 21:9664497-9664519 AGCCTACTGCTGCACTGTGGGGG - Intergenic
1178518329 21:33266785-33266807 GTCCTCCTGCAGCTCTCTGCTGG + Intronic
1178894597 21:36548359-36548381 GGCCTGATGCAGCTCTGGGACGG - Intronic
1179688014 21:43065202-43065224 GAGATCCTGCAGCAGTGTGATGG - Exonic
1179789809 21:43749798-43749820 GGTCACCTGCCGCCCTGTGAGGG + Intronic
1181309725 22:21938134-21938156 GGGCTCCTGCAGGCCTGGGAAGG - Intronic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1183220939 22:36512592-36512614 GCTCTCCTGCAGCACTGTAATGG - Exonic
1184031923 22:41900313-41900335 GGGCTCCTGCAGCAGTGACAGGG - Exonic
1184192695 22:42905516-42905538 GGCCTGCTGCTGTTCTGTGATGG - Intronic
1184302340 22:43568991-43569013 TGCCTCTTGCAGGAATGTGAGGG - Intronic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1184777463 22:46630606-46630628 GAGCTCCTGGAGCACTGAGAGGG - Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185339320 22:50284490-50284512 GGTCACCTTCAGGACTGTGAGGG - Intronic
950105598 3:10386377-10386399 GGCCTCCTCCAGCTGTGTGCTGG + Intronic
950428280 3:12936332-12936354 GGCGTCCTCCAGCTCGGTGATGG + Exonic
950899316 3:16482941-16482963 GGCCTCTTGCAGCAGTATCAAGG + Intronic
951857524 3:27214285-27214307 GACCTCCTGAGGCAGTGTGACGG + Intronic
952877931 3:37963112-37963134 CTAATCCTGCAGCACTGTGACGG - Intronic
954274336 3:49532614-49532636 GGCCACAAGCATCACTGTGACGG + Exonic
954657993 3:52209077-52209099 AGCGTCCTTCAGCACTGTCAAGG + Intronic
956897824 3:73681902-73681924 GGCCTCCTGCATTAGTGTAATGG - Intergenic
958627705 3:96646835-96646857 AGCCCCCTGCTGCACTGTGGGGG - Intergenic
958917522 3:100066225-100066247 TGCCTCCTGCAGCTCTCTGTGGG + Intronic
960052447 3:113251321-113251343 GGCCTCCTGTCTCTCTGTGAGGG + Intronic
961101360 3:124201949-124201971 GGCCAGCTGGAGCCCTGTGATGG + Intronic
961435048 3:126911205-126911227 GGCCTCGTGGAGCTCTGAGATGG - Intronic
962599029 3:136976502-136976524 GGACTCCTGCAGCAAGGTAAGGG - Intronic
968311059 3:197683371-197683393 GGGCTCCTGAAGCAGTTTGAGGG - Exonic
968616255 4:1579081-1579103 GGCGTCCAGCAGCGCTGGGAAGG - Intergenic
969211557 4:5691811-5691833 GGCCTCCTCCAGCCCTGCAATGG + Intronic
971319038 4:25590551-25590573 GGCCTGCTCCCACACTGTGATGG + Intergenic
973140824 4:46765935-46765957 GGCCTACTCCAGCACTAGGATGG + Intronic
973275223 4:48299942-48299964 GGCCTCCTGCTGCAGAGAGAGGG + Intergenic
975139219 4:70902758-70902780 GGGCTCCTGCAGCCCTGAGGAGG + Intronic
980872165 4:138623685-138623707 GGCCTCATGGAGCCCAGTGAGGG + Intergenic
981049666 4:140297761-140297783 TGTCTCCTGCACCTCTGTGATGG - Intronic
981469046 4:145108664-145108686 GGCCTACTGCAGCAGGGAGAAGG + Intronic
982086368 4:151840764-151840786 GGTTTTCTGCAGGACTGTGAGGG + Intergenic
982538678 4:156639822-156639844 GGTCTCTTGGAGCAATGTGATGG + Intronic
982770095 4:159389900-159389922 GGCCTCCGCCAGCACAGAGACGG - Intergenic
983186352 4:164705563-164705585 GGACTCTTCCAGCAATGTGATGG + Intergenic
983282480 4:165698518-165698540 GGCTTCATCCAGCACTGTGGTGG + Intergenic
983673000 4:170259855-170259877 GCCTTCCTGAAGCACTGAGATGG + Intergenic
984819977 4:183873579-183873601 TTCCTCCTGGAGCACTGTGCTGG + Intronic
985564761 5:609899-609921 CCCCTCCTGCAAGACTGTGAAGG - Intergenic
988378982 5:30477049-30477071 GCCCTCATGGAGAACTGTGAGGG - Intergenic
988610021 5:32714345-32714367 GGCCTCAGCCACCACTGTGAGGG - Intronic
988836851 5:35041519-35041541 GCCCCCCTGCAGCAGTGGGATGG + Intronic
989622392 5:43397269-43397291 TTTCTCCTGCAGCTCTGTGAAGG - Intronic
991471752 5:66976292-66976314 GGCCTGCAGCAGAACTCTGATGG - Intronic
992179630 5:74183703-74183725 GGCCTCATGCATGACTTTGATGG - Intergenic
994146836 5:96404679-96404701 AGCCTCCCACAGCCCTGTGAGGG - Intronic
994517591 5:100790463-100790485 GGCCACCTGTAGCACTGAGGTGG + Intergenic
995513224 5:112928520-112928542 AGCCTCCTGCAGCAGAGGGAGGG - Intergenic
996298608 5:121954370-121954392 GGCCTCCGGCAGCCCAGAGAGGG + Intergenic
997418354 5:133747013-133747035 GGCCACCAGGGGCACTGTGAGGG + Intergenic
998135041 5:139670018-139670040 GGGGTTCTGCAGCACTGTGGCGG + Intronic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
1001680641 5:173554607-173554629 GGCCTCCTGGAAGACTGTGTTGG - Intergenic
1002203122 5:177542874-177542896 GGCCCTGTGCTGCACTGTGAGGG - Intronic
1202773867 5_GL000208v1_random:42449-42471 GGACACTTGCAGCACTTTGAAGG - Intergenic
1003124042 6:3341009-3341031 GGCCACCTTCAACCCTGTGAAGG - Intronic
1004368115 6:15029093-15029115 GGCCTCAGGCAGCACTGTGTGGG - Intergenic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1006047505 6:31309405-31309427 GGCCGACTGGATCACTGTGATGG - Intronic
1006494603 6:34413312-34413334 GGCCTCCTGCAGGGCAGTGTGGG - Intronic
1006796970 6:36738006-36738028 GGCCTCCTGAGGCCCTGTCACGG - Intergenic
1007933586 6:45713990-45714012 GGCTTTCTGCAGCACTGGGAGGG - Intergenic
1011002513 6:82606890-82606912 GCCCTGCTGCAGCACTGTGATGG + Intergenic
1014603940 6:123448737-123448759 GGCCTCCTGCACCAAAGTGCAGG - Intronic
1015008211 6:128310588-128310610 GACCTTTTGCTGCACTGTGAAGG + Intronic
1017755485 6:157525781-157525803 GGCATCCAGCAGCAGTGGGACGG - Intronic
1018081209 6:160260677-160260699 GCCCTCCTACAGCTCTTTGACGG - Intronic
1018185727 6:161264284-161264306 AGCATCCTGCAGCTCTGGGAGGG - Intronic
1019151672 6:170010722-170010744 GGGCTCCTGCAGCATGGTCAGGG + Intergenic
1019285035 7:219145-219167 GGCTTCCTGCATCACGGAGAAGG - Intronic
1019773345 7:2897315-2897337 TTCCTCCTGCAGCACTGGGCTGG + Intergenic
1019962511 7:4472801-4472823 GGCATCCTGCAGGACAATGAGGG - Intergenic
1022465076 7:30648196-30648218 GGCCTGCTGCAGCGCTGTATGGG + Intergenic
1022980929 7:35604152-35604174 TGCCACCTGCAGCACTGCAATGG + Intergenic
1023236817 7:38098928-38098950 GGCCTCCTCCAGATCTGTGATGG - Intergenic
1024472768 7:49780482-49780504 GGTCTCCTGGAGGACTGTGATGG + Intronic
1024623889 7:51188056-51188078 GTCCTGCTGCAGCAGTGAGAAGG + Intronic
1026237055 7:68535543-68535565 AGCCTGCTGCTGCACTGTGGGGG - Intergenic
1026310655 7:69181041-69181063 GGCCTTCTGCAGAGCTGAGATGG + Intergenic
1028323538 7:89493306-89493328 GGCCTCCTGAGGCACAGTCAGGG + Intergenic
1030407474 7:109132832-109132854 GGAATCCAGCAGCATTGTGAAGG + Intergenic
1030915375 7:115305436-115305458 GGAGTCCTGGTGCACTGTGAAGG - Intergenic
1034066821 7:148145001-148145023 GGCTTCCCGCAGCAATGTCAGGG + Intronic
1034453211 7:151149005-151149027 GGCCCCCTGCAGAACTGTCCAGG + Exonic
1035090440 7:156305752-156305774 TGCACCCTGCAGCACTGTGCTGG - Intergenic
1035613774 8:987482-987504 GGCGTCCGGCAGAACTGTGCTGG - Intergenic
1037747860 8:21661172-21661194 AGCCTGCTGCAGCACAGTGGTGG + Intergenic
1040285526 8:46098658-46098680 GGCCTCATGCAGGCCTGTGTGGG + Intergenic
1044086978 8:87954323-87954345 TCCCTCCTGCAGCCTTGTGAAGG + Intergenic
1044456056 8:92393992-92394014 AGCCTACTGCTGCACTGTGAGGG - Intergenic
1044725305 8:95189960-95189982 GTCCTCATACAGCACTGGGAGGG - Intergenic
1045702118 8:104879319-104879341 TCTCTCCTGCCGCACTGTGAAGG - Intronic
1046540025 8:115567816-115567838 TGCCTCCTGCAGCTCTTTCAGGG + Intronic
1051253769 9:15190634-15190656 GGCCTCCTGCAGTTACGTGAAGG - Exonic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1053272949 9:36762705-36762727 CGTCTCCTGCAACACTGTGCAGG + Intergenic
1053472916 9:38359635-38359657 GGCTTCCTGAAGCACTGGGATGG + Intergenic
1057063425 9:92026275-92026297 GGCCTCCAGGAGCCCTGAGAGGG + Intergenic
1057076975 9:92142972-92142994 CGTCACCTGCTGCACTGTGAAGG - Intergenic
1057893822 9:98890405-98890427 AGGCTCCTGCAGCACAGTGCAGG + Intergenic
1058202051 9:102055837-102055859 GGCCTGCTGCAGCAGAGTGGAGG - Intergenic
1059888153 9:118769637-118769659 GACCTCCTGAAGCAGTGTCATGG - Intergenic
1061140658 9:128764257-128764279 GGCCTCGTGCAGACCTCTGATGG - Intronic
1061715382 9:132515361-132515383 GTCCTCCTGCAGCCCTGGGAGGG - Intronic
1061782419 9:133003908-133003930 GGCCTCCTGAAGCCCTGAGAAGG - Intergenic
1061848837 9:133402997-133403019 GCCCTCCTGCTGGACGGTGAGGG + Exonic
1062123668 9:134848101-134848123 GTGCTCCTGCGGCACTGTGGGGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062276687 9:135734736-135734758 GGCTTCCTCCAGCACTGCGGTGG + Intronic
1203417913 Un_KI270362v1:2406-2428 GGACACTTGCAGCACTTTGAGGG - Intergenic
1203662330 Un_KI270753v1:57265-57287 AGCCTACTGCTGCACTGTGGGGG + Intergenic
1185458780 X:324087-324109 GGCCTCCTGAAGCCCTTGGATGG - Intergenic
1186283430 X:8018800-8018822 GGCATCCTGAAGCATTCTGAGGG - Intergenic
1186909488 X:14146760-14146782 TCCCTCTGGCAGCACTGTGAAGG + Intergenic
1187813462 X:23206356-23206378 GGCTTCCTGCAACTCTCTGATGG + Intergenic
1194185071 X:90765583-90765605 AGCCTGCTGCTGCACTGTGGGGG + Intergenic
1195105970 X:101601461-101601483 GGCCCTCTGCAGCACTCTGCTGG - Intergenic
1195106913 X:101612306-101612328 GGCCCTCTGCAGCACTCTGCTGG + Intergenic
1195228961 X:102826855-102826877 GCCCTCCTGCAACACTGGAATGG - Intergenic
1195300936 X:103529322-103529344 GTCCTCCTGCAGCAGTGTATAGG - Intergenic
1196009363 X:110870744-110870766 GGCCTCCAGCTGCCCTGTGAGGG - Intergenic
1196916366 X:120539660-120539682 GGTCTCATGTAGCCCTGTGAGGG + Intronic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic
1198259487 X:134952983-134953005 GGCAGCCTACAGAACTGTGATGG - Intergenic
1199360154 X:146907721-146907743 GGCCTCCTGCTCCACAGAGAAGG - Intergenic
1199680602 X:150221867-150221889 TGCCTCCTGCAGCACTTTGAAGG + Intergenic
1200204424 X:154305573-154305595 GGCCACTTGGAGCCCTGTGATGG + Intronic
1200748451 Y:6923013-6923035 AGCCCCCTGCTGCACTGTGGGGG - Intronic
1201712163 Y:17004586-17004608 AGCTTCCTGCAGTAGTGTGAAGG + Intergenic