ID: 1051784051

View in Genome Browser
Species Human (GRCh38)
Location 9:20722306-20722328
Sequence TTGTGGATGTCTAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051784051_1051784057 23 Left 1051784051 9:20722306-20722328 CCCTCTTCTCTAGACATCCACAA 0: 1
1: 0
2: 1
3: 10
4: 257
Right 1051784057 9:20722352-20722374 GTGTGTGTTCCACACCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051784051 Original CRISPR TTGTGGATGTCTAGAGAAGA GGG (reversed) Intronic
900797843 1:4720028-4720050 TTGTGGATGTCTAGCTTAAAAGG + Intronic
901154250 1:7124886-7124908 TCGTGGAAGCCTAGAGAAGTGGG + Intronic
904626688 1:31810082-31810104 CTGTGGATGTCCAGAGGGGAGGG - Intronic
904656885 1:32055483-32055505 ATGTGGGTCTCAAGAGAAGAGGG - Intronic
905950123 1:41943561-41943583 TTGTCTGTGTGTAGAGAAGATGG - Intronic
906844325 1:49174799-49174821 TTTAGGATGTCTAGAGAGAAAGG - Intronic
907080779 1:51619672-51619694 TAGAGGAGGTCTAGTGAAGAGGG + Intronic
907346246 1:53783459-53783481 TTTTGGATGTTGAGAAAAGATGG - Intronic
907348419 1:53804147-53804169 TTCTGGAAGTCTAGAAAGGAAGG - Intronic
909699752 1:78510161-78510183 TTGTGGCCTTCTAGAGGAGAGGG - Intronic
910240177 1:85078107-85078129 TTGTCTATGTGTAGAGAAGCAGG + Intronic
911317135 1:96369259-96369281 TTTTGTATTTTTAGAGAAGACGG - Intergenic
911746214 1:101444572-101444594 TTCTGGTTGACTGGAGAAGAAGG - Intergenic
912111038 1:106343993-106344015 TTGCTGATGTCTATAGAAAAAGG - Intergenic
912315522 1:108664375-108664397 ATTTGGAGGTCTTGAGAAGAGGG + Intergenic
914352838 1:146855165-146855187 CTGTGGATCGCTAGAGGAGATGG + Intergenic
915007747 1:152655769-152655791 TTCTAGATGCTTAGAGAAGATGG + Intergenic
915805203 1:158841205-158841227 TTGTGTATTTCTAGAGCATAAGG + Intronic
916051198 1:161038297-161038319 TTGGGGAGGTCAAGAGAAGCTGG + Intronic
917245398 1:172995641-172995663 GTGTGGATGTGTTGAGGAGAAGG - Intergenic
917722940 1:177803385-177803407 TTGTGGATCTCTGGAGATGGTGG - Intergenic
918627349 1:186671572-186671594 TTGTGTATCTTTACAGAAGATGG - Intergenic
919446981 1:197718966-197718988 TTATGAAAGTCAAGAGAAGAGGG + Intronic
919501519 1:198343133-198343155 TTGTGTATTTCTAGTAAAGAAGG + Intergenic
921734193 1:218608356-218608378 TTGTGAATTTCTAGAAAACAGGG - Intergenic
921750681 1:218789697-218789719 TTGGGGATGAGAAGAGAAGAGGG - Intergenic
922039464 1:221882382-221882404 TTGTGTATGCCTGGAGAAGGGGG + Intergenic
922883096 1:228997439-228997461 TCATGGAGGCCTAGAGAAGACGG - Intergenic
923985565 1:239377899-239377921 TTTTGGAATACTAGAGAAGAAGG + Intergenic
924143074 1:241046309-241046331 TTGGGGATGACTAGAAAAGGGGG - Intronic
924333828 1:242967050-242967072 ATGAGTATTTCTAGAGAAGAAGG + Intergenic
924431827 1:244004004-244004026 TAGTGGAGCTCCAGAGAAGATGG + Intergenic
924836434 1:247652497-247652519 TTGTGGTTCTCCAGAGAAGATGG - Intergenic
1063418766 10:5894105-5894127 TTTTGGATTTCTGGAGAAGCAGG + Intronic
1065437089 10:25714045-25714067 TTGTGGGTGTGTAGACAAAAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067851152 10:49755361-49755383 TTGTGTATGTCTAGAGAAAAGGG - Intronic
1068716472 10:60194421-60194443 TGGTGGATGTCAAGGGTAGAGGG - Intronic
1068752910 10:60616828-60616850 TTGTGAATGTTTAGAGAAATGGG - Intronic
1070683311 10:78464463-78464485 TTGGGGAAGTCAAGATAAGATGG + Intergenic
1071063400 10:81600885-81600907 ATGTGTATGTCTAGAGAAGCAGG - Intergenic
1071457693 10:85863449-85863471 TAGTGGATGTCTTGTGCAGAAGG + Intronic
1073665996 10:105534499-105534521 TTGTGGATGTCTAGGGCTGGGGG + Intergenic
1074767783 10:116713319-116713341 TGGTGGATGTCCAGAGTAAATGG + Intronic
1075762944 10:124870456-124870478 TTGTGTATTTCTAGTAAAGAAGG - Intergenic
1076050256 10:127327778-127327800 TTATTGAGGTCTTGAGAAGAAGG - Intronic
1077875505 11:6301656-6301678 TTGTGGATGTGTAATGAACAGGG + Intergenic
1079231842 11:18655850-18655872 TTTTGGATTTTTAGTGAAGATGG - Intergenic
1080693674 11:34582018-34582040 TTGTGGATGCCTGGGGAAGTCGG + Intergenic
1081635438 11:44718453-44718475 TGGAGGATGTCATGAGAAGACGG - Intergenic
1081845996 11:46240876-46240898 TTTTGTATTTCTAGAAAAGATGG + Intergenic
1084511336 11:69606197-69606219 TTGTGGATGACTCTAGCAGAGGG - Intergenic
1085695335 11:78699668-78699690 TAGTTGATGTTTAGTGAAGAAGG - Intronic
1086799260 11:91151739-91151761 TCTTAGATGTCTAGAGCAGAAGG + Intergenic
1087675159 11:101153186-101153208 TTGTGGAAGAATAGAGAAGAAGG - Intergenic
1088245852 11:107817401-107817423 ATCTGGAGGCCTAGAGAAGATGG + Intronic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1091190900 11:133694601-133694623 ATGTGGATGACTAGAGATCATGG - Intergenic
1091965879 12:4741196-4741218 GTGTGGAAGTCTAAAAAAGAAGG - Intronic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1093260039 12:16924642-16924664 TTGTGTATATTTAGAGAATAAGG + Intergenic
1093492351 12:19719507-19719529 CTGTAGATGTCCAGATAAGAAGG + Intronic
1093542933 12:20309335-20309357 TTGTGAATGTCAAGAAAACAGGG + Intergenic
1095979326 12:47962257-47962279 TTGTGGAGGTCTGGGGAAGGGGG + Intergenic
1096655940 12:53092160-53092182 TTGTGGGTGTTTTGAGAATAGGG - Intergenic
1097277842 12:57825278-57825300 TTGTGGCTGCCTAGAACAGAGGG - Intronic
1098590040 12:72200271-72200293 TTGTGGATGTATTGAGGAGAGGG + Intronic
1098829647 12:75345470-75345492 ATGGGTAAGTCTAGAGAAGAAGG - Intronic
1099812625 12:87604432-87604454 TTTTGTATCTTTAGAGAAGAGGG - Intergenic
1100524236 12:95405061-95405083 CTGTGGCTCTCTAGAGCAGAGGG - Intergenic
1101047138 12:100820161-100820183 TTCTAGATGTTTAGAGCAGAAGG + Intronic
1101895073 12:108750306-108750328 TTTTGTATTTCTAGCGAAGATGG + Intergenic
1102852778 12:116265871-116265893 ATGTGGCTTGCTAGAGAAGAAGG - Intronic
1104829322 12:131738266-131738288 TATTGTATGTCAAGAGAAGAAGG + Intronic
1105657778 13:22459120-22459142 TTGTGGATGTGTAAAGCAGTAGG - Intergenic
1105789908 13:23788421-23788443 TGGTGGAGGTCTTGAGAACATGG - Intronic
1107204481 13:37766320-37766342 ATGTGGATGTATAGAGAATGAGG + Intronic
1107721327 13:43251564-43251586 TTGTAGGAATCTAGAGAAGATGG + Intronic
1108581572 13:51832669-51832691 TTGTGCAGGGCTGGAGAAGAGGG - Intergenic
1108962833 13:56257787-56257809 TTGTGGGTGAGTAAAGAAGATGG + Intergenic
1109561685 13:64057781-64057803 TAGGGCAGGTCTAGAGAAGAAGG - Intergenic
1111463875 13:88582054-88582076 TTATGGTTGTCTAGAGAAAGAGG - Intergenic
1111947423 13:94680434-94680456 TTTTGTATTTCTAGTGAAGACGG - Intergenic
1112045988 13:95598494-95598516 TGGTAAATGTCTAGAGAACAAGG + Intronic
1112325838 13:98442414-98442436 TTGAGGATGTCTTCAGAAGCAGG - Intronic
1112951585 13:105004339-105004361 TTATTTATCTCTAGAGAAGACGG - Intergenic
1113173259 13:107530572-107530594 ATGTGGATGTATGCAGAAGATGG + Intronic
1114004722 14:18300066-18300088 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1114541640 14:23464868-23464890 TAGTGGTTGTCTAGAGCTGAGGG + Intergenic
1116551692 14:46247813-46247835 TTGTGGATATCTGCAGCAGATGG + Intergenic
1117325524 14:54665725-54665747 TTAGGGATGGTTAGAGAAGATGG - Intronic
1117493101 14:56272208-56272230 TCCGGGATGTCTAGACAAGAGGG + Intronic
1118899548 14:69974879-69974901 TTGTGACTGTCTTGAGATGAGGG - Intronic
1119752082 14:77086386-77086408 TTTTGGGTTTCTAGAAAAGAAGG - Intergenic
1119949028 14:78725565-78725587 TTGTGGATTTCCACAGAAGGAGG - Intronic
1123389184 15:19852312-19852334 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1124395648 15:29299529-29299551 AGGTGGATGTCTAGTTAAGAAGG - Intronic
1124419189 15:29504997-29505019 TTGTAGATGACAAGAGAAAAAGG + Intronic
1124793040 15:32748169-32748191 TTTTTGGTGTCTAGAGAACATGG - Intergenic
1125134162 15:36322426-36322448 TTTCTGAAGTCTAGAGAAGATGG - Intergenic
1126327159 15:47491847-47491869 TTGTGCCTGCCTAGAGCAGAAGG + Intronic
1128004885 15:64229479-64229501 TTGTGGAACTATAGAGAAGGAGG + Intronic
1128422629 15:67508313-67508335 TTTAGGATGTCTTTAGAAGATGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130525422 15:84701894-84701916 TTGTGTATTTTTAGTGAAGATGG - Intronic
1131337378 15:91562277-91562299 TTGGGGATTTCTAGGGAAGTAGG + Intergenic
1131363259 15:91814375-91814397 AGGTGGATGTCAAGAGAAGAAGG - Intergenic
1131525383 15:93148352-93148374 TGGTGGAAGACAAGAGAAGAGGG + Intergenic
1135194574 16:20383899-20383921 TTGAGGATGTGTGGAGAATAAGG - Intronic
1135236765 16:20764010-20764032 TCGTGGCAGTCTAAAGAAGAGGG - Exonic
1135616840 16:23918103-23918125 TTGTGAATCTCTAAACAAGAGGG + Intronic
1137627214 16:49916737-49916759 TTGTGGATGCCTAGACTGGAGGG - Intergenic
1137942021 16:52697522-52697544 ATATGGTTGTATAGAGAAGAGGG + Intergenic
1138860521 16:60750461-60750483 TGATGGATTTCTTGAGAAGAGGG - Intergenic
1139890375 16:70249777-70249799 TTTTGTATTTTTAGAGAAGATGG - Exonic
1139981188 16:70860353-70860375 CTGTGGATCGCTAGAGGAGATGG - Intronic
1142425256 16:89999188-89999210 ATGTGTAGGTCTTGAGAAGAAGG + Intergenic
1143738624 17:8934922-8934944 TTGAGACTGACTAGAGAAGAAGG - Intronic
1144520991 17:15952071-15952093 CTTTGGTTGTCTGGAGAAGAGGG + Intronic
1145914877 17:28566762-28566784 TTGTGTATGTTTAGTGGAGAAGG + Intronic
1147304443 17:39553641-39553663 TTGTGGATTCCTAGAAATGAAGG + Intronic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1149732744 17:58962701-58962723 CTGTGGAGGTATATAGAAGAAGG - Intronic
1151661874 17:75523481-75523503 TCGTGTGTGTCTAGGGAAGAGGG + Intronic
1154532704 18:15363802-15363824 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1154950075 18:21201554-21201576 TTGTGGATGTCAAGGGGTGAGGG - Intergenic
1155825650 18:30439368-30439390 GTGCGCATGTCTAGAGCAGAGGG - Intergenic
1156599956 18:38594206-38594228 GTGTCGTTATCTAGAGAAGATGG + Intergenic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1158314331 18:56194138-56194160 TTGTGTATGTTTAGTAAAGATGG + Intergenic
1161620988 19:5296989-5297011 TTGGGGATGTACAGAAAAGAGGG + Intronic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1164828947 19:31305613-31305635 TTGTGGATAGAAAGAGAAGAGGG + Intronic
1165484030 19:36084517-36084539 TTGTGCATGTCTAGAGTATTTGG + Intronic
925353162 2:3217079-3217101 TTGTGGATGAGGAGAGAAAAGGG + Intronic
926497907 2:13614676-13614698 TTGTGTATGTTTAGAGATAAGGG + Intergenic
929411798 2:41705061-41705083 TTGTGAAGGTCTTAAGAAGAGGG + Intergenic
931571007 2:63669189-63669211 TTCTGGATTTCTAAAGAAAATGG - Intronic
932010397 2:67971958-67971980 TTTAGGATGTGGAGAGAAGAAGG - Intergenic
933529168 2:83484311-83484333 TTGTGGAAGTACAGAGGAGAGGG - Intergenic
933665804 2:84963918-84963940 TGGTGAATGTTTATAGAAGAGGG + Intergenic
934971648 2:98769134-98769156 TTGTGGATGTCTGGAGGTTAGGG + Intergenic
937515597 2:122651759-122651781 TAGTGGATGTGTAGACAACATGG - Intergenic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
940084503 2:149843467-149843489 TTATTGATGGCTAGAGAATAAGG + Intergenic
942586343 2:177483211-177483233 TAGTGGTTGTCTTGAGATGATGG - Intronic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
943530148 2:189069157-189069179 TTGTGGAGGTTCAGAGGAGAGGG - Intronic
944241434 2:197489231-197489253 TTGTAGGTGTTTGGAGAAGAGGG - Exonic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
946117890 2:217479526-217479548 TTGTGGAGGTCTAGAAAGGGAGG - Intronic
947537740 2:230951510-230951532 TGGCAGATGTCTAGGGAAGAGGG + Intronic
948829093 2:240588917-240588939 GTGTGGATGTTTTGAGTAGACGG + Intronic
1170135058 20:13063823-13063845 TTGTGTATGTTTAGTGGAGATGG + Intronic
1170225149 20:13983869-13983891 TTGTGGGTGTATAGAGAACCAGG - Intronic
1170684100 20:18553562-18553584 TTGTGGATGAGTATAAAAGAAGG + Intronic
1173922325 20:46755610-46755632 ATGTGGATACCTGGAGAAGATGG - Intergenic
1176764657 21:13004409-13004431 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1180429236 22:15230856-15230878 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1182660025 22:31918631-31918653 TTGTCTATGTCTTGAAAAGAAGG + Intergenic
1183506277 22:38210744-38210766 TTGTGGATATCTAGGGAACAAGG + Intronic
951667215 3:25140526-25140548 TTGTGGATGACCAAAGAAAATGG + Intergenic
952629359 3:35446283-35446305 TTGTGAATGGCTAGTGAAGGAGG + Intergenic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
955432098 3:58856711-58856733 TAGTCTTTGTCTAGAGAAGATGG + Intronic
955649915 3:61182913-61182935 ATGTGGATGTCTAAAAGAGATGG - Intronic
958745544 3:98129335-98129357 TTGTACATGTCCAGAGAAGGAGG + Intergenic
958748361 3:98164696-98164718 TTGTACATGTCCAGAGAAGGAGG + Intergenic
958752140 3:98204043-98204065 TTGTACATGTCCAGAGAAGGAGG + Intergenic
959538351 3:107512556-107512578 TTGGTCATGTCTAGAGTAGATGG + Intergenic
960279961 3:115770213-115770235 TTCTAGAAGTCTAGAGAAAATGG - Intergenic
961091337 3:124115120-124115142 TAGAGGAGGCCTAGAGAAGAAGG + Intronic
963480894 3:145873337-145873359 TAGTGGTTGTCAAGAGATGATGG + Intergenic
963626208 3:147677231-147677253 TGGTGGAAGTCTCGTGAAGAAGG + Intergenic
963942069 3:151105335-151105357 TTCTGGAAGTCTGGAGAAAAAGG - Intronic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
971431896 4:26577060-26577082 CTGAGGTTTTCTAGAGAAGAAGG + Intronic
974197659 4:58597206-58597228 TAGTCGATGTCTTGAGAAGTGGG - Intergenic
975844285 4:78508647-78508669 TTGTGGATCTCTAAAGAAAGGGG + Intronic
976393251 4:84527647-84527669 GTGTGCATGTCTAAAAAAGAAGG + Intergenic
976810751 4:89098783-89098805 TAGTGGTTGTCAAGAGCAGAAGG + Intronic
977599580 4:98921892-98921914 TTGTGGATTTCTAAAGAAAGTGG - Intronic
979028545 4:115608735-115608757 TTAGTGATATCTAGAGAAGAGGG - Intergenic
980189289 4:129502727-129502749 GTGTGGATGTGAAGAGAGGAGGG + Intergenic
980873022 4:138631881-138631903 TTGTGAATGTCTTGGGAAAAAGG - Intergenic
981157258 4:141453655-141453677 TTGTGGATGGTTTGAGAAAAGGG + Intergenic
981206274 4:142044326-142044348 ATTTGTATGGCTAGAGAAGAAGG + Intronic
981984810 4:150841098-150841120 ATGGGTATGTCTAGAGAAAAGGG - Intronic
982024815 4:151241423-151241445 TAGTGGTTGTCTAGAGTTGAAGG + Intronic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985802052 5:2010935-2010957 TTAGGGTTCTCTAGAGAAGAGGG - Intergenic
987292583 5:16522660-16522682 TTGTGTATGTCCATAGAAGAGGG - Intronic
989519834 5:42388734-42388756 TTATGGAGGTGTTGAGAAGATGG - Intergenic
989995110 5:50819839-50819861 ATGTGCATCTCTAGAGTAGAAGG + Intronic
990127236 5:52533761-52533783 TAATGGAGGTCTAGACAAGATGG + Intergenic
990146740 5:52769530-52769552 TTGAGGTTCTATAGAGAAGACGG + Intergenic
990723078 5:58720228-58720250 TTGTAGATATATAGAGAATATGG + Intronic
991164812 5:63553049-63553071 TTTTGGAACTCAAGAGAAGATGG - Intergenic
991921578 5:71662771-71662793 TAGTGGATGGCTAGGGAAGGTGG + Intergenic
995514507 5:112940621-112940643 TTTAGGATGTCTAGATGAGATGG + Intergenic
996072468 5:119149254-119149276 GATTGGATGTCTAGAGAAGACGG + Exonic
996202715 5:120696626-120696648 AAGTGGTTCTCTAGAGAAGATGG + Intergenic
997248702 5:132372353-132372375 TTGGGGCTGCCTAAAGAAGAGGG + Intronic
998084006 5:139301277-139301299 TTATGGAAGTCAAGAGAATAGGG + Intronic
1000301526 5:159960947-159960969 CTGTGAATGACTAGAAAAGAGGG - Intronic
1003763582 6:9210303-9210325 TTTTGGATGTCTAGAGCCTATGG - Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004963546 6:20821024-20821046 AGGAGGATGCCTAGAGAAGAGGG + Intronic
1009571290 6:65388962-65388984 TTGTGGATGTATATTTAAGATGG - Intronic
1009583117 6:65562555-65562577 ATGTGGAGGTCCAGAGAACATGG - Intronic
1009639723 6:66318299-66318321 TTGAGCATATCTAGAGAAAAGGG + Intergenic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1010836384 6:80592189-80592211 TTGAGGATCTCAAGAAAAGAGGG - Intergenic
1011069306 6:83363140-83363162 TAGTGGATCACTAGAGATGATGG - Intronic
1012272636 6:97233426-97233448 TTGTGGAACTCCAGAGGAGAGGG - Intronic
1012672780 6:102076545-102076567 TTTTGGATGTTTAGTGGAGACGG - Intergenic
1016257477 6:142125211-142125233 TTGGGTATGTCATGAGAAGAAGG + Intergenic
1016959413 6:149657197-149657219 TTGTGTATGTGAAGAGTAGAGGG - Intergenic
1018175134 6:161171991-161172013 GTTTGGATGCCTAGACAAGAAGG - Intronic
1019775806 7:2911571-2911593 TTGGGGATGGCAAGAGCAGATGG - Intronic
1021650906 7:22832051-22832073 TTTTGGAGGACTAGAGATGATGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1027229719 7:76265116-76265138 CTGGGGTTGTCTAGAGAAAAGGG + Intronic
1028950221 7:96626202-96626224 TTATGGACGTATAGAGTAGAAGG - Intronic
1031751551 7:125581169-125581191 TGTTGGATGTCAAAAGAAGATGG - Intergenic
1035854877 8:2964099-2964121 TTGTGTATCTTCAGAGAAGAAGG - Intronic
1038651291 8:29406055-29406077 TTGTTGAGGTTTTGAGAAGATGG + Intergenic
1038652960 8:29422234-29422256 TTGTGTATGTTTAGAAGAGATGG - Intergenic
1040885637 8:52260695-52260717 GTGTGTATGTGTATAGAAGAAGG - Intronic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041980071 8:63847348-63847370 AGATGGATGTCAAGAGAAGAGGG + Intergenic
1044561293 8:93614885-93614907 TTTGGGATGTGAAGAGAAGAGGG - Intergenic
1045330238 8:101149670-101149692 TTGTGGCTCTCTAGACGAGATGG + Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046994550 8:120502868-120502890 CTGTGTATGTCTATGGAAGATGG - Intronic
1047326791 8:123846901-123846923 TTCTGTATTTTTAGAGAAGACGG - Intergenic
1047327427 8:123853323-123853345 TTCTGTATTTTTAGAGAAGACGG + Intronic
1047514545 8:125542254-125542276 TTGTGGAGGGCAAGTGAAGAAGG + Intergenic
1050970596 9:11867597-11867619 TTGTGTCTGTCAGGAGAAGAAGG + Intergenic
1051580642 9:18670081-18670103 CTGAGGTTGTCTAGAGAAGATGG + Intronic
1051784051 9:20722306-20722328 TTGTGGATGTCTAGAGAAGAGGG - Intronic
1052140970 9:24982846-24982868 TTGTGCATTTTTAAAGAAGACGG + Intergenic
1052603420 9:30669984-30670006 TTGTGGCTCTAGAGAGAAGAGGG + Intergenic
1052715927 9:32117074-32117096 ATGTGCATGTGGAGAGAAGATGG - Intergenic
1053710413 9:40801521-40801543 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1054420321 9:64922310-64922332 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1055251262 9:74309104-74309126 TTGTGTTTCTCTAGAAAAGATGG - Intergenic
1055629879 9:78212525-78212547 TTGCAGATGCCTTGAGAAGAAGG - Intergenic
1057021580 9:91702009-91702031 TTGTGAGGGTGTAGAGAAGAGGG - Intronic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1058148353 9:101436504-101436526 TTTTGGAGGACTGGAGAAGATGG - Intergenic
1059826942 9:118041325-118041347 TGATGGATGTATAGAGAGGATGG - Intergenic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1062167832 9:135116932-135116954 GAATGGATGTCTTGAGAAGAAGG + Intronic
1186823205 X:13312566-13312588 AGGTGGATGTGCAGAGAAGACGG + Intergenic
1187999670 X:24968901-24968923 TTATGGATTCTTAGAGAAGAAGG - Intronic
1188788831 X:34382907-34382929 TTGAGGATGTCAAGACAATAAGG + Intergenic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1190913570 X:54793545-54793567 TTGTGGATGTCTTCTAAAGATGG - Intronic
1193398989 X:81020350-81020372 TTCTGGATGTTTACAGAGGATGG + Intergenic
1194783402 X:98052443-98052465 TTGTAGATGTTTAGAGATAAGGG + Intergenic
1195817303 X:108902853-108902875 TTGGGGATGTCTAGCTAAGTGGG - Intergenic
1195992248 X:110694129-110694151 TTGTGGAAGTATACAAAAGAAGG + Intronic
1197074240 X:122336387-122336409 TAGTGGATCACTAGGGAAGATGG + Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200072622 X:153536623-153536645 TTGTGGAGGTGTGGAGATGAGGG - Intronic
1201252988 Y:12079484-12079506 TTGAGAATGTTTAGAGAATAAGG + Intergenic