ID: 1051785994

View in Genome Browser
Species Human (GRCh38)
Location 9:20744189-20744211
Sequence AGTTTCTAAGAGGATGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051785994_1051785997 14 Left 1051785994 9:20744189-20744211 CCTTGAACATCCTCTTAGAAACT 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1051785997 9:20744226-20744248 GTGCATAAGGAGCTCATCTTTGG No data
1051785994_1051785996 1 Left 1051785994 9:20744189-20744211 CCTTGAACATCCTCTTAGAAACT 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1051785996 9:20744213-20744235 ACACTTGTTTACTGTGCATAAGG No data
1051785994_1051785998 30 Left 1051785994 9:20744189-20744211 CCTTGAACATCCTCTTAGAAACT 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1051785998 9:20744242-20744264 TCTTTGGAGTTTTTAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051785994 Original CRISPR AGTTTCTAAGAGGATGTTCA AGG (reversed) Intronic
901779335 1:11583041-11583063 AGTATCAAAGAGGATCTTCTTGG + Intergenic
904603876 1:31688658-31688680 AGGTGCTAAGAGGAAGTTCCAGG + Intronic
904733973 1:32616135-32616157 AGTTTGGAAGAGAATGTTCAAGG - Intronic
907081994 1:51632415-51632437 AGTTTCTATGTGGGTGATCAAGG + Intronic
908270614 1:62418223-62418245 TGTTTCTGTGAGGATGTTCCTGG - Intergenic
911046510 1:93633284-93633306 AGATTCTAACAGGATGTAAATGG - Intronic
912145428 1:106788151-106788173 AGTGTCTATGAGCATGATCAAGG - Intergenic
912554360 1:110505422-110505444 AGTTTCTGAGAAGCTGTTCTTGG + Intergenic
912598874 1:110907243-110907265 ATGTTTTAAGAGGAGGTTCAGGG - Intergenic
913655399 1:120955114-120955136 AGTCTCAAAGAAAATGTTCAAGG + Intergenic
914793232 1:150898166-150898188 TCTTTCTAGGATGATGTTCAGGG + Intergenic
914892208 1:151635905-151635927 AGTTTCTCTGACGATTTTCAGGG + Intronic
915615241 1:157032774-157032796 AGTAACTGGGAGGATGTTCATGG - Intronic
915643363 1:157247584-157247606 AGTTTTAAATAGGATGGTCAGGG - Intergenic
915827148 1:159090036-159090058 AGGGTCTATGAGGAGGTTCAAGG + Intronic
917123327 1:171663670-171663692 AGTTCCCAGGAGGATGCTCAGGG - Intergenic
917783021 1:178419736-178419758 AGAGTCGAGGAGGATGTTCAGGG + Intronic
917839097 1:178963173-178963195 AGTTTTAAATAGGATGGTCAGGG + Intergenic
923867527 1:237955821-237955843 AGTTTCCTAAAGGATGTTCAAGG - Intergenic
924074222 1:240316541-240316563 TGTTTCTAAGATGTTTTTCAGGG + Intronic
1064867261 10:19895196-19895218 TGTATCTAAGAGGATGATGATGG + Intronic
1065772353 10:29089361-29089383 ATTTTCTAAGAGAATGTACCTGG - Intergenic
1068978911 10:63040161-63040183 AGGATCAAAGAGGAGGTTCAGGG + Intergenic
1069393476 10:67962756-67962778 ATTTTCTAAGAGCATTTTCTAGG - Intronic
1069893689 10:71667476-71667498 AGTTTCTAGGAGAGTGTGCAGGG + Intronic
1072779123 10:98232556-98232578 AGTTATTAAGAAGATTTTCAGGG + Intronic
1073015213 10:100393562-100393584 GGTTTGTAAGATGAAGTTCAGGG - Intergenic
1073019642 10:100432186-100432208 AATTTCTGAGGAGATGTTCATGG - Intergenic
1074650358 10:115515972-115515994 TATCTCTAAGAGGATATTCAGGG - Intronic
1076347180 10:129787269-129787291 AGTATCTAACAGGATGTTGTGGG - Intergenic
1078356087 11:10632514-10632536 AGCTTGTAAGATGATGTTCTAGG - Intronic
1078970150 11:16400303-16400325 AATTTTAAATAGGATGTTCAAGG + Intronic
1079213223 11:18482744-18482766 ATTTTTTAAAAGTATGTTCAGGG - Intronic
1080356295 11:31450712-31450734 AACTTCTCAGAAGATGTTCATGG - Intronic
1081846225 11:46242512-46242534 AGTTTTTAAAGGGATTTTCAAGG - Intergenic
1083251783 11:61472786-61472808 TGTTTCTATGAGGATGTTTTTGG + Intronic
1084362314 11:68677017-68677039 AGATTCTAAGAGGCTGTAAACGG + Intergenic
1087183704 11:95163007-95163029 AGTTTCTAACAGGTTTGTCATGG + Intergenic
1087436275 11:98122534-98122556 ATTTTCTAAAAGGATGCTCCTGG + Intergenic
1088891919 11:114051342-114051364 AGTTTCTGTGAGAATGCTCAAGG - Intergenic
1090826285 11:130388886-130388908 AGTCTTTAAGAGGACATTCAAGG - Intergenic
1091045027 11:132317787-132317809 AGTGTCTTAGAGGATGTGGAAGG + Intronic
1091584107 12:1806128-1806150 AGCTTCAAAGTGGATCTTCAAGG - Intronic
1093893006 12:24545990-24546012 AGTTTCTGGGAGGATTCTCAGGG - Intergenic
1094606274 12:31951866-31951888 AGATTCTAAGAAGGTGTCCATGG + Intergenic
1095486260 12:42687852-42687874 AATTTCTAAGTCTATGTTCAGGG - Intergenic
1099853933 12:88140751-88140773 AGTTTCTAAAAGGGTGTGTAGGG - Intronic
1101192348 12:102348081-102348103 AGTTTCTAGGAGGATATGCATGG - Intergenic
1101401920 12:104395935-104395957 GCTGTCTAAGAGGATGTTTATGG + Intergenic
1101563550 12:105882940-105882962 TCTTTCTAAAAGGATATTCATGG - Intergenic
1101808548 12:108087494-108087516 ATTTGCTATGAGGATGTTTATGG - Intergenic
1101920156 12:108925857-108925879 AGTTTTAAATAGGATGGTCAGGG - Intronic
1105721055 13:23114859-23114881 AGCTTCTAAGAGGATGGTGGAGG - Intergenic
1106090329 13:26586639-26586661 AGTTCCTAAGAGAATTGTCAGGG + Intronic
1107259888 13:38477437-38477459 AGTTTCTAAAAAAATGTTGAAGG - Intergenic
1107261617 13:38498567-38498589 TGTTTCTAAGAGGGCGTTTATGG + Intergenic
1108481486 13:50877070-50877092 AGTTACTAATACCATGTTCATGG - Intergenic
1108572225 13:51763147-51763169 AGAATCTAAAAGAATGTTCAAGG + Exonic
1108726894 13:53192733-53192755 AGGATCTAGGAGGAGGTTCATGG - Intergenic
1108802551 13:54117102-54117124 AGTTTATAAGAAGATGGTAAGGG + Intergenic
1109973833 13:69805928-69805950 AATTTCTAATAGGCTGCTCAAGG + Intronic
1110422107 13:75323164-75323186 AATATCTAAGAAGATGTTAATGG + Intronic
1112037544 13:95510940-95510962 AGGTACTAAGAAAATGTTCAGGG + Intronic
1112704962 13:102058017-102058039 ATTTGCTAAGAACATGTTCAAGG + Intronic
1113156127 13:107324306-107324328 AAGTTCTAAAAGGATTTTCATGG - Intronic
1113295887 13:108958070-108958092 AGTTTCCAAGAGGGTGGACAAGG + Intronic
1113661632 13:112110867-112110889 AGTTTCCAATGGGATGTTGATGG - Intergenic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1115840597 14:37465328-37465350 AGTTTTTAAGATGCTGTTGATGG - Intronic
1115853748 14:37607932-37607954 AGTTAGTAAGAGTATGTGCATGG - Intronic
1116168442 14:41365083-41365105 AGTTTTTTGGGGGATGTTCAAGG + Intergenic
1117469849 14:56032105-56032127 AGATTGTAAGAGGAGGTTGAAGG + Intergenic
1118459499 14:65975773-65975795 AGTTTCTAAGAGATTGTCCCAGG + Intronic
1122873638 14:104652741-104652763 AGTTTCGAAGAGGTAGTTTAAGG - Intergenic
1123465763 15:20514005-20514027 TGTTTCTAGGAGGATTTTCCTGG + Intergenic
1123652351 15:22487034-22487056 TGTTTCTAGGAGGATTTTCCTGG - Intergenic
1123742773 15:23295893-23295915 TGTTTCTAGGAGGATTTTCCTGG - Intergenic
1123760552 15:23428595-23428617 TGTTTCTAGGAGGATTTTCCTGG + Intergenic
1124154305 15:27211899-27211921 AGTTTCTCAGGGGATGGGCATGG - Intronic
1124157633 15:27241030-27241052 ATTATCTAAGAGGTTGTTGAGGG - Intronic
1124217254 15:27817608-27817630 AGTTTCTAAGAGGATCATGGAGG - Intronic
1124276487 15:28329982-28330004 TGTTTCTAGGAGGATTTTCCTGG + Intergenic
1124306214 15:28581625-28581647 TGTTTCTAGGAGGATTTTCCTGG - Intergenic
1125330752 15:38579905-38579927 GGGTTCTAACAGGATGTTTAGGG + Intergenic
1126330881 15:47529871-47529893 AGTTTGAAAGAGCATGTTCCAGG + Intronic
1126550650 15:49925473-49925495 AGTTTTTCAGAGGATGCACAAGG - Intronic
1127260159 15:57321585-57321607 AGTTTCCAAAAGGGTCTTCATGG + Intergenic
1130448237 15:84024566-84024588 GGTTTCTAACATGATGTCCATGG - Intronic
1130785079 15:87087149-87087171 AGTTTTAAATAGGATGATCAGGG + Intergenic
1131003952 15:88960635-88960657 AGCTGCTAAGATGATGCTCACGG + Intergenic
1131610370 15:93954865-93954887 AGTGTATAAGATGATGTTCATGG + Intergenic
1134027067 16:10962544-10962566 GTTCTCAAAGAGGATGTTCAAGG - Exonic
1135734117 16:24917215-24917237 AGTTTCTTATAGAATGTTCTAGG - Intergenic
1135748484 16:25037435-25037457 AGTTTCTTGGGGGAGGTTCATGG - Intergenic
1136471690 16:30484959-30484981 TGTTTCTAATAGGATGTCCCAGG - Intronic
1138824340 16:60300843-60300865 TGTTTCTATGAGGATGTTTTTGG + Intergenic
1141332320 16:83122781-83122803 AGTATCTAAAAAGATATTCAAGG + Intronic
1143395362 17:6590524-6590546 CCTTTCTAACATGATGTTCACGG + Exonic
1145795139 17:27651114-27651136 AGTGTCTAAGAAGAAGCTCAAGG + Intergenic
1147394696 17:40132833-40132855 AGATTCTAAAAGGATGTGGATGG + Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1149040898 17:52187012-52187034 AGTTTCTCAAAGGAAATTCATGG + Intergenic
1150270364 17:63860396-63860418 TGTTTCTAAGAAGTAGTTCAGGG - Intergenic
1153128313 18:1823972-1823994 ATTTTCTATGAGCATGATCAAGG + Intergenic
1153135858 18:1916927-1916949 ACTTTCTAAGAGGATCTTTCTGG + Intergenic
1154100936 18:11472928-11472950 AGATTCTAAGAGTATGTCCATGG + Intergenic
1158190555 18:54823434-54823456 AATTTTTAAGAGGATGGTGAAGG + Intronic
1158275389 18:55761227-55761249 AATTTCTCAGAGGGTCTTCACGG - Intergenic
1158567250 18:58565163-58565185 CGTTTCTAAGGAAATGTTCATGG - Intronic
1159667927 18:71186134-71186156 AGTTTTTAAGAAGCTATTCATGG + Intergenic
1161688322 19:5715209-5715231 AGCTTCAAAGGGGATGTCCAGGG + Intronic
925527290 2:4816951-4816973 AGTTTCTAAGAAAAGGCTCAAGG - Intergenic
925867273 2:8239750-8239772 AGTTTCCAAGAAAATGTCCATGG + Intergenic
926907757 2:17821834-17821856 AATTTCTAAGAAAATATTCAGGG - Intergenic
927012437 2:18919144-18919166 TCTTTCTAAGAGGATCATCACGG + Intergenic
927283445 2:21332084-21332106 AGTTTCTGTGAGGGTGTTAATGG + Intergenic
928362379 2:30675870-30675892 AGTTTCAAAGTGGGTGTTCCTGG + Intergenic
929753174 2:44738814-44738836 AGTTTTAAAGAGGATGGTCAGGG + Intronic
930408059 2:50987481-50987503 AGTTTGTAACAGGATCTTCTAGG - Intronic
930760922 2:55034962-55034984 ATTTTTTAAGAGGCTGTTCTAGG - Intronic
930979211 2:57501677-57501699 AGATTCAAAGAGGTTGGTCATGG + Intergenic
933634697 2:84694553-84694575 AGTTTGTAGGATGAAGTTCAAGG + Intronic
940524841 2:154799979-154800001 AATTTCAAATAGGATGGTCAGGG + Intronic
940902522 2:159138698-159138720 AGTTTCTAAGACGCTTTTCTGGG + Intronic
940906955 2:159178446-159178468 TGTTTCAAGGAGGATTTTCATGG - Intronic
941598645 2:167510638-167510660 AGTATCAAAGATGATTTTCAGGG + Intergenic
942125640 2:172822522-172822544 TGTTTCTCAGAAGATGATCAGGG + Intronic
942752117 2:179299811-179299833 AGTTTTCAAAAGGATGGTCAAGG - Intergenic
944120815 2:196238799-196238821 AGTTCCTAGGAGGAGGTCCAGGG - Intronic
945375014 2:209069355-209069377 AGTTTCTGAGAAGATGTACTAGG - Intergenic
945727069 2:213484039-213484061 AGTTTCTAAGTGAATGTTTATGG + Intronic
946966867 2:225044956-225044978 AGTTAATAAGAGAATCTTCAAGG + Intergenic
1170063315 20:12283624-12283646 AGTTTCTAAGTGGCAGTTCAGGG - Intergenic
1172796928 20:37546582-37546604 AGTTTCAGAAAGGATGGTCAGGG - Intergenic
1173151531 20:40570370-40570392 AGTGGCTAGGAGGATGGTCAGGG + Intergenic
1174663790 20:52238315-52238337 ACTTTCTGTGAGGATGATCATGG + Intergenic
1175649352 20:60704336-60704358 AATATTCAAGAGGATGTTCATGG - Intergenic
1176340714 21:5692768-5692790 AGCTGCTGAGAGGATGCTCAGGG + Intergenic
1176342493 21:5711354-5711376 AGTTTTTATGAATATGTTCATGG - Intergenic
1176472968 21:7124921-7124943 AGCTGCTGAGAGGATGCTCAGGG + Intergenic
1176474747 21:7143505-7143527 AGTTTTTATGAATATGTTCATGG - Intergenic
1176502334 21:7613102-7613124 AGTTTTTATGAATATGTTCATGG + Intergenic
1176504113 21:7631688-7631710 AGCTGCTGAGAGGATGCTCAGGG - Intergenic
1176536814 21:8109423-8109445 AGTTTTTATGAATATGTTCATGG - Intergenic
1182246557 22:28962925-28962947 TCTTTCCAAAAGGATGTTCAGGG - Intronic
1182684417 22:32110557-32110579 AGTTTCTAAAACAATATTCAAGG - Exonic
1203239978 22_KI270733v1_random:7226-7248 AGCTGCTGAGAGGATGCTCAGGG + Intergenic
1203241762 22_KI270733v1_random:25829-25851 AGTTTTTATGAATATGTTCATGG - Intergenic
950432078 3:12956618-12956640 GGATTCTAAGAGGATGTTCTTGG + Intronic
952386844 3:32847978-32848000 AGTATATGGGAGGATGTTCATGG + Intronic
953463045 3:43096807-43096829 AGTTTCTAAAGGGATTTTCTAGG - Intronic
954701979 3:52455376-52455398 AGTTTCTAGCAGGCTGTGCAGGG + Intronic
955223689 3:57043974-57043996 TGTCTCTCAGAGGATGGTCATGG - Intronic
955407663 3:58635696-58635718 TGTTTCTAAGAGGATGTATTTGG - Intronic
957281118 3:78152927-78152949 ATAGTCTAAGAGGATTTTCATGG - Intergenic
957802468 3:85103251-85103273 AGTTTCTAAGAAAAGATTCAGGG + Intronic
958211823 3:90491493-90491515 AATTTCTAAGTGGATATTTAGGG - Intergenic
961053041 3:123763378-123763400 AATTTCCAAGAGGATGGTGAGGG - Intronic
963298697 3:143575690-143575712 TGTTTTAAAGAGAATGTTCAGGG + Intronic
965276775 3:166693349-166693371 ATTTTCCAAGAGCATGTTCAGGG + Intergenic
967451656 3:189630762-189630784 AGCTTCTAAGGGGATGTGAAAGG + Intergenic
971847317 4:31936168-31936190 AGTTTCTAAGATAATATTGAAGG + Intergenic
972062462 4:34894226-34894248 ACTTTTTAAGAGGATTTTAATGG + Intergenic
972233466 4:37101993-37102015 TGTTTCTAATCAGATGTTCAAGG - Intergenic
972235665 4:37131142-37131164 AGTTTCTAATTGTATGTGCAAGG - Intergenic
975699446 4:77048826-77048848 AATTTCTAAGATGATGTTGATGG - Intronic
975764566 4:77654288-77654310 AGTTTCTTAGATGATCGTCATGG + Intergenic
975948049 4:79732139-79732161 AGTTTTTGAGACCATGTTCATGG - Intergenic
976538370 4:86243697-86243719 AGTTTTAAATAGGATGGTCAAGG - Intronic
976639472 4:87322821-87322843 GATTTCTAGGATGATGTTCATGG + Exonic
976661818 4:87547642-87547664 AGTTTTAAATAGGATGATCAAGG - Intergenic
977368742 4:96106845-96106867 ACTTTCTATGGGAATGTTCATGG - Intergenic
980652848 4:135743114-135743136 AGTTTTAAATAGGATGGTCAGGG - Intergenic
982229180 4:153192864-153192886 AGTTTTAAATAGGATGGTCAAGG - Intronic
982284880 4:153724475-153724497 AGACTCCAAGAGGATGTGCAGGG - Intronic
982418910 4:155170706-155170728 AATTACTAACAGAATGTTCAGGG - Intergenic
984424136 4:179562320-179562342 AGTTGATAAGAGGAGGTTAAAGG - Intergenic
986023097 5:3823051-3823073 AGTTTCTAAGATCATGTTTCTGG - Intergenic
986118757 5:4808914-4808936 AGTTGCTAAAAGAATATTCAGGG + Intergenic
987831372 5:23100104-23100126 AATATCTGAGAGGATGTTCTAGG + Intergenic
987925443 5:24335423-24335445 AATTTCCAAAAGGGTGTTCAGGG - Intergenic
989189122 5:38653002-38653024 AGTTCTTAACAGAATGTTCATGG - Intergenic
990265225 5:54068754-54068776 ACTTACTAAGAGCCTGTTCAGGG - Intronic
990698953 5:58454592-58454614 TCTTTGTAAGAGCATGTTCAGGG + Exonic
991455030 5:66793777-66793799 AGTTTGAAACAGGATGGTCAAGG - Intronic
991918205 5:71626503-71626525 TGTTTTTAAAATGATGTTCAGGG + Intronic
997575271 5:134970893-134970915 AGTTTTTGAGAGGAGATTCAAGG - Intronic
1000391156 5:160724803-160724825 AGTTTTAAATAGGATGGTCAAGG - Intronic
1001282123 5:170393859-170393881 TGTCTCAAAGAGGATTTTCAAGG - Intronic
1001541609 5:172543392-172543414 AATTTTTAAGAGGATTTTGAAGG - Intergenic
1003124620 6:3346459-3346481 AGTCACTAAGAGGATTTGCAGGG - Intronic
1005135489 6:22565748-22565770 AGTATCAATGAGGATGTTCTAGG - Intergenic
1005218650 6:23561075-23561097 AGTCTCTAAGAGAAGGTTCTTGG - Intergenic
1006151483 6:31992432-31992454 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1006157784 6:32025170-32025192 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1008284623 6:49632969-49632991 AGTATCTCAGGGGATATTCATGG + Intronic
1008395449 6:51001448-51001470 ATTTTCTAAGAGTGTGGTCAAGG - Intergenic
1008866357 6:56215488-56215510 AGTTTCTAGTAGTATGTTCAGGG - Intronic
1009708131 6:67282172-67282194 AGTTTGTAAGAAAATATTCATGG + Intergenic
1013135485 6:107278251-107278273 AGTATCTAAGAGTAAATTCATGG + Intronic
1013406575 6:109849182-109849204 AGAATCTAAGAGGCTGTCCAAGG - Intergenic
1014123834 6:117754739-117754761 AGTTTCTAGCTGTATGTTCATGG - Intergenic
1014869310 6:126572134-126572156 AGTTTCGAAGAGGATATTCTAGG + Intergenic
1015850869 6:137570500-137570522 AGTTGTTAAGACGATGATCACGG + Intergenic
1016077440 6:139814393-139814415 AGTTTTTACAAGGATGTTTATGG - Intergenic
1016563203 6:145420572-145420594 GTTTTCTAAGTGGATGTTCACGG - Intergenic
1017299715 6:152842605-152842627 AGTTTCAAAGGGGATTTTCCAGG + Intergenic
1018242022 6:161786826-161786848 AGTTTCTCAGAGTATGGTTATGG + Intronic
1019003285 6:168774173-168774195 ATTTTCTTAGAGGTTGTTCTAGG + Intergenic
1019675188 7:2307329-2307351 AGTTTCTCAGAGGATGACAATGG + Intronic
1020691821 7:11364782-11364804 AGGTTCTAACAGGATGTTTTGGG + Intergenic
1021822699 7:24514057-24514079 AGTTATTAAGAGGATGTGCTAGG + Intergenic
1021941219 7:25680680-25680702 ACTTTCTGAGAGGTTGTTCTAGG - Intergenic
1022299728 7:29091619-29091641 AGTTTCTAGGGGGATGCCCAGGG - Intronic
1026572836 7:71546861-71546883 AGTTTCTGAGAGGAGGCTAATGG - Intronic
1031903610 7:127437225-127437247 AGTTTCCAAAAGGAAGTTCAAGG + Intergenic
1032906527 7:136373905-136373927 AGTTTAAAACAGGATGATCAGGG + Intergenic
1034550728 7:151818992-151819014 AATTTCAACAAGGATGTTCACGG - Intronic
1034911635 7:155002887-155002909 AGTTCCTGAGGAGATGTTCAGGG - Exonic
1036451696 8:8873242-8873264 ATTTTTTAATAGCATGTTCAGGG + Intronic
1036593686 8:10192848-10192870 CGTTTATAACAGCATGTTCATGG + Intronic
1038226469 8:25662824-25662846 AATTTCTGAGAGGAAATTCAAGG - Intergenic
1040690056 8:49926195-49926217 ATTTTCTAAGAAGAGGTTCTAGG + Intronic
1042092594 8:65175058-65175080 AGTTCTGAAGAGGAAGTTCAGGG - Intergenic
1042988955 8:74617002-74617024 ACTTTTTCAAAGGATGTTCATGG - Intronic
1043125937 8:76394951-76394973 ACATTCTAAGAAGATGCTCATGG + Intergenic
1043249457 8:78052805-78052827 AGTTTCTAAGACAATATTCACGG - Intergenic
1043550248 8:81363498-81363520 ATGTTTGAAGAGGATGTTCAAGG + Intergenic
1044136652 8:88594291-88594313 AGATTCAAAGAGGTTCTTCAAGG + Intergenic
1044415214 8:91930808-91930830 AATTTCTAAAAGAATGTTAAGGG + Intergenic
1046105864 8:109665715-109665737 AGTTTCTTAGAATATGTACATGG - Intronic
1047677003 8:127213173-127213195 AGGTGCTAAGAGGATGTTTATGG + Intergenic
1051785994 9:20744189-20744211 AGTTTCTAAGAGGATGTTCAAGG - Intronic
1052051555 9:23854231-23854253 AGTTTCTAAAAGGATAGCCAAGG - Intergenic
1052581750 9:30365767-30365789 AGATTTTTAGAGAATGTTCATGG + Intergenic
1053572987 9:39329169-39329191 AGGTTCTAAGAGGGGATTCAGGG - Intergenic
1054124157 9:61289842-61289864 AGGTTCTAAGAGGGGATTCAGGG + Intergenic
1057719823 9:97523101-97523123 AGTATCCAAGAAGATCTTCAAGG + Intronic
1062114090 9:134798282-134798304 CTTTTCTCAGAGGATGTGCAGGG + Intronic
1203422353 Un_GL000195v1:5225-5247 AGCTGCTGAGAGGATGCTCAGGG - Intergenic
1203458084 Un_GL000220v1:8905-8927 AGTTTTTATGAATATGTTCATGG - Intergenic
1188001672 X:24988289-24988311 AGTTTCTGAGACCATGTTAATGG - Intronic
1194861647 X:99005850-99005872 AGTTTCTAAGAGCATGTTAGTGG + Intergenic
1195590649 X:106621703-106621725 AGTTTTTAATAGGATGGTTAGGG + Intronic
1197028695 X:121787614-121787636 AATTTGAAATAGGATGTTCAAGG + Intergenic
1197375754 X:125680364-125680386 TGTTTCTGTGAGGATGTTTAAGG - Intergenic
1198140140 X:133794403-133794425 AGTTGCTAAGAAGAAATTCAAGG + Intronic
1198637627 X:138716792-138716814 AGTTTCTAAAAGGATGGTTCTGG - Intronic
1198638832 X:138732962-138732984 AGTTTCACAGAGGATATTGATGG + Intronic
1200616107 Y:5381383-5381405 AATTTTTAACAGGATGGTCAGGG - Intronic
1200703232 Y:6419949-6419971 AGTGTCTAAGAGGCTGTTTGTGG + Intergenic
1201030878 Y:9744758-9744780 AGTGTCTAAGAGGCTGTTTGTGG - Intergenic
1201651268 Y:16290131-16290153 TGTTTCTATGATTATGTTCATGG + Intergenic
1201673492 Y:16552132-16552154 AGTTTCCAAGCAGATGTTCTAGG - Intergenic