ID: 1051788518

View in Genome Browser
Species Human (GRCh38)
Location 9:20773202-20773224
Sequence AAATATATGCTAAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051788518_1051788524 -4 Left 1051788518 9:20773202-20773224 CCCCCCACCTTTAGCATATATTT 0: 1
1: 0
2: 1
3: 15
4: 262
Right 1051788524 9:20773221-20773243 ATTTATTAAGCAGATGCCTATGG No data
1051788518_1051788526 13 Left 1051788518 9:20773202-20773224 CCCCCCACCTTTAGCATATATTT 0: 1
1: 0
2: 1
3: 15
4: 262
Right 1051788526 9:20773238-20773260 CTATGGCAAACACTTTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051788518 Original CRISPR AAATATATGCTAAAGGTGGG GGG (reversed) Intronic
903138080 1:21322319-21322341 AAGCATTTGCTAGAGGTGGGTGG - Intronic
903731954 1:25503291-25503313 TAAAATATGCTCAAGGAGGGAGG - Intergenic
904510791 1:31005521-31005543 AAATAAAAGCAAAAGGGGGGTGG - Intronic
905921551 1:41722584-41722606 AAATACCTGCTAAAAGTGGAGGG - Intronic
907495432 1:54841115-54841137 AAATATTTGTCAAAGGAGGGAGG - Intronic
907604344 1:55801916-55801938 TAATAGATGCTAAAGGTGGAAGG + Intergenic
907779262 1:57550622-57550644 AGATATATGGTAAAGTTGGATGG - Intronic
908721137 1:67127479-67127501 AAATTTATGATAAAGGTGAGGGG + Intronic
910110003 1:83672870-83672892 AAATAACAACTAAAGGTGGGAGG + Intergenic
911755966 1:101557186-101557208 AAATAAATGATAAAGTTGGTGGG - Intergenic
911870941 1:103097645-103097667 CATTATATGCTAAAGGTAGTTGG - Intronic
912037601 1:105339939-105339961 AAAGATATGCTAAATGTTTGAGG + Intergenic
912858670 1:113193691-113193713 ACATATGTGGTAAAGGAGGGAGG + Intergenic
916844030 1:168630164-168630186 AAAATTATGATAAATGTGGGTGG + Intergenic
917347712 1:174045757-174045779 AGATAACTGCTAGAGGTGGGTGG - Intergenic
918772023 1:188573583-188573605 AAATAGATTGTAAAGGTGGCTGG - Intergenic
919106394 1:193156821-193156843 AAATATTTGCTAAAGGAAAGAGG - Intronic
919230498 1:194766668-194766690 AAATAAATGATAAATGTGTGAGG + Intergenic
919603908 1:199656524-199656546 AATTATATGCTATAGGGGAGTGG - Intergenic
923612889 1:235511053-235511075 AAAAATGTGCTCAAGGAGGGAGG + Intergenic
923854629 1:237832806-237832828 AAGTAAATACAAAAGGTGGGGGG - Exonic
924671248 1:246128325-246128347 AAATATATTCTAGAGGTAGGAGG - Intronic
1065890188 10:30114242-30114264 AATTATTTGATAAATGTGGGTGG + Intronic
1066690983 10:38027990-38028012 AAATCTATTCTGAAGCTGGGTGG + Intronic
1067001714 10:42620682-42620704 AAATCTATTCTGAAGCTGGGTGG - Intronic
1068550435 10:58402180-58402202 AAAAATATGTTAAAGCTGGAAGG + Intergenic
1068628949 10:59280056-59280078 AAATATATGTTGAAGTTTGGAGG - Intronic
1069041738 10:63703011-63703033 CTATATATGCTAAAGGAGAGAGG + Intergenic
1070451096 10:76557842-76557864 AAATCGATGCTAAAGGAAGGTGG - Intronic
1070546447 10:77456588-77456610 AAATGTTTGCTGAAGGAGGGAGG + Intronic
1074616210 10:115070885-115070907 AAATATATGCTGTATTTGGGGGG + Intergenic
1080142569 11:28940463-28940485 AAATATATATTAAATGTAGGCGG - Intergenic
1081337639 11:41886516-41886538 AAAGAAATGCAATAGGTGGGTGG + Intergenic
1081544379 11:44059693-44059715 AAATCCATCCCAAAGGTGGGAGG + Intronic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1087223209 11:95568751-95568773 TTAGATTTGCTAAAGGTGGGTGG - Intergenic
1087256687 11:95963963-95963985 CAATATGTGCCAAAGGTGGCTGG + Intergenic
1088888184 11:114024016-114024038 AAATATATGCTAACTGAGGCCGG - Intergenic
1088967536 11:114738786-114738808 TAATATAAGCATAAGGTGGGGGG - Intergenic
1089546426 11:119230026-119230048 AAAGAAATGTTAAAGTTGGGGGG + Intronic
1089768671 11:120786804-120786826 AAATATTTGCTGTAGGTGGGGGG - Intronic
1089886967 11:121835437-121835459 AAATAAATAGTAAAGGTGAGAGG + Intergenic
1091939965 12:4470452-4470474 AAAAAGAATCTAAAGGTGGGAGG - Intergenic
1094084353 12:26573444-26573466 ATTTACATGCTAAAGGGGGGTGG + Intronic
1094231541 12:28110033-28110055 AAATATGTGCTAGAGGTTGTAGG + Intergenic
1094809238 12:34121791-34121813 AAAAATATATTAAAGGTGGATGG - Intergenic
1095724651 12:45438222-45438244 AAATATGTGCTGAATGTGGCAGG - Intronic
1095978353 12:47955173-47955195 AAGTATATGCTAAGGGAGGCTGG - Intergenic
1098920178 12:76295578-76295600 AAGTATATGCATCAGGTGGGAGG - Intergenic
1099350364 12:81560358-81560380 AACTATATGTGAAAGGTGGAAGG + Intronic
1104557253 12:129811944-129811966 AAATATATGTGTCAGGTGGGTGG - Intronic
1105487043 13:20844783-20844805 AAATATCTGTTGAAGGTGAGAGG + Intronic
1107966818 13:45604636-45604658 AAAAATAGTCCAAAGGTGGGAGG + Intronic
1108703051 13:52959900-52959922 AAGTATATGCGTCAGGTGGGAGG + Intergenic
1109343856 13:61092485-61092507 AAATATATGCGTCAGGTGTGAGG - Intergenic
1109423181 13:62139737-62139759 AGATATATGCCTAAAGTGGGTGG - Intergenic
1110698627 13:78520845-78520867 AATTATATGGCAAAGGTGTGGGG - Intergenic
1112655694 13:101450645-101450667 GAATTTGTACTAAAGGTGGGTGG + Intergenic
1113837098 13:113335458-113335480 AAAGAAATGGTAAATGTGGGTGG - Intronic
1114662217 14:24354267-24354289 AAATATTTGCTGAATGAGGGAGG - Intergenic
1114953308 14:27784628-27784650 AAACATATGATAAAGGCAGGAGG - Intergenic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1116026032 14:39516487-39516509 AAATAAATGATAAATGTGTGAGG + Intergenic
1116118875 14:40695262-40695284 TAACATATGCCAAAGGTGGTTGG + Intergenic
1117718518 14:58605465-58605487 AAATATTTGTTAAACCTGGGTGG - Intergenic
1118200661 14:63668983-63669005 AAAGATATGGTAAAGGTTTGAGG - Intergenic
1118597101 14:67444200-67444222 CAACATATGCTCAAGGTGGTCGG - Intergenic
1120207859 14:81605588-81605610 AATGATATGCTAATAGTGGGAGG + Intergenic
1120639881 14:86997866-86997888 AAATATTTTATAGAGGTGGGTGG - Intergenic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1125426730 15:39556396-39556418 AAATATGTACTGAAGTTGGGTGG + Intergenic
1125792644 15:42380714-42380736 ATATATATGGGGAAGGTGGGGGG - Intronic
1127648607 15:60983831-60983853 GAACATATGCTCAAGGTGGTTGG - Intronic
1129496438 15:75986607-75986629 AAATATATGTTAGAAGTGGGTGG + Intronic
1130208937 15:81905310-81905332 AAATTTATTTTAAAGGTGTGGGG - Intergenic
1130211855 15:81931218-81931240 AAATATGTACTTAAGCTGGGTGG + Intergenic
1130607784 15:85333034-85333056 AAAGAAATGCTAAAAGTGGCCGG - Intergenic
1133919006 16:10135183-10135205 AATTATATGCTACAGTTGTGTGG - Intronic
1134357930 16:13501704-13501726 AAATATTTGCTGAAAGAGGGCGG + Intergenic
1134592597 16:15467763-15467785 GAACATATGCTCAAGGTGGTTGG + Intronic
1135194663 16:20384568-20384590 AGCTATAGGGTAAAGGTGGGAGG - Intronic
1136669280 16:31841142-31841164 AAATAAATGATAAATGTGTGAGG + Intergenic
1136893832 16:33985360-33985382 AAATAAATTCTAGAGGTGGACGG + Intergenic
1137363694 16:47842526-47842548 AAGTATATGCATCAGGTGGGAGG - Intergenic
1139337756 16:66245072-66245094 AAATATGTGGTGAAGGTGGCAGG - Intergenic
1141316577 16:82968082-82968104 AAATAAATTCTTAAGTTGGGGGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1203079201 16_KI270728v1_random:1138262-1138284 AAATAAATTCTAGAGGTGGACGG - Intergenic
1147511675 17:41074833-41074855 AAATATATTCTAAAAGTGGTAGG - Intergenic
1150265436 17:63829549-63829571 AACTAAATGCTAAAGGTGAGTGG + Exonic
1150717742 17:67586291-67586313 AAATTTATACTAAAGTTGGCTGG + Intronic
1151502996 17:74504316-74504338 AAGTATATGCATCAGGTGGGAGG - Intergenic
1153138258 18:1942166-1942188 GAATATGTGCTCAAGGTGGTTGG + Intergenic
1155060693 18:22225728-22225750 AAACATAGGATATAGGTGGGAGG - Intergenic
1155174089 18:23288009-23288031 AAGTATATGCTTCAGGTGTGAGG - Intronic
1155671166 18:28372812-28372834 AATTATGTGCTAAATGTGGTTGG - Intergenic
1155892547 18:31286699-31286721 AAGTATATGCGTCAGGTGGGAGG + Intergenic
1156060234 18:33065260-33065282 AAATATATGATAAAGGCACGAGG + Intronic
1157143556 18:45137441-45137463 AAATAATTGGTAAGGGTGGGCGG - Intergenic
1157357749 18:46951088-46951110 AAATACATACTGATGGTGGGAGG - Intronic
1157694081 18:49706925-49706947 AGAGACTTGCTAAAGGTGGGTGG + Intergenic
1158917707 18:62151986-62152008 GAATATTTGCTCAAGGTGGTCGG + Intronic
1160263183 18:77314882-77314904 CAAAATATGTTAAAGGTGGACGG + Intergenic
1166573835 19:43818087-43818109 AAATATATGTTAAAGGATAGAGG + Intronic
925207511 2:2019552-2019574 AAATATATTCTCAGTGTGGGGGG + Intronic
925365526 2:3309190-3309212 AATTATATTCTTAAAGTGGGAGG + Intronic
925433566 2:3817479-3817501 AAATATATGCATCAGGTGTGAGG + Intronic
925704517 2:6671085-6671107 AAATAAATTTTAGAGGTGGGGGG + Intergenic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
926473220 2:13287994-13288016 AAATACCTACTAAAGGTGTGGGG + Intergenic
927715858 2:25352252-25352274 AAATATATACTAAAGTTGTCGGG + Intergenic
927825076 2:26302842-26302864 AAAAATATATTAAAGGTGGATGG + Intergenic
928730510 2:34226421-34226443 AAATATTTATTAAAGGTGTGAGG - Intergenic
928800120 2:35079197-35079219 AAATATATGATCATGGTGGAAGG + Intergenic
931948512 2:67335562-67335584 AAGTATATGCTTCAGGTGTGAGG - Intergenic
934133154 2:88969214-88969236 AAATATGTGCCCAAGGTGGCTGG - Intergenic
934141238 2:89049993-89050015 AAACATATGCCTAAGGTGGTTGG - Intergenic
934220624 2:90078931-90078953 AAATATGTGCCCAAGGTGGTTGG + Intergenic
934228002 2:90150552-90150574 AAACATATGCCTAAGGTGGTTGG + Intergenic
934484013 2:94684821-94684843 AAACATATGATAAAGGCAGGAGG + Intergenic
934639409 2:96018494-96018516 AAATATATGCTAAAAGCTTGGGG - Intergenic
934794243 2:97086891-97086913 AAATATATGCTAAAAGCTTGGGG + Intronic
935239525 2:101166332-101166354 AAATAAATGTTAGGGGTGGGTGG + Intronic
935829311 2:106983836-106983858 AAATAAATGGTGGAGGTGGGGGG - Intergenic
936833350 2:116676863-116676885 AAATATATACTAAAGGAAGCAGG + Intergenic
936933564 2:117815244-117815266 AAATAGATGTGAAAAGTGGGTGG - Intronic
939094797 2:137822331-137822353 AAGTATATGCGTCAGGTGGGAGG - Intergenic
939935134 2:148282261-148282283 ATATATATGCCAAAGGTGATGGG - Intronic
940751579 2:157632042-157632064 AAATAGATGATTAAGGTGGCGGG - Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
948647056 2:239411920-239411942 CAATAAAGGCTAGAGGTGGGTGG + Intergenic
1168958834 20:1854410-1854432 AAATATATGCTCAGGGCTGGGGG - Intergenic
1169655282 20:7915852-7915874 AACTACATGCTAATGATGGGTGG + Intronic
1170817181 20:19723513-19723535 ATATATATTCCCAAGGTGGGAGG + Intergenic
1173386944 20:42597317-42597339 CAATATATGGTAAAAGTGAGGGG - Intronic
1178074390 21:29001753-29001775 AAATAAGTGTTAAAGATGGGGGG + Intergenic
1178672109 21:34600563-34600585 AAATAAATGCTAATGCTTGGTGG - Intronic
1179634078 21:42696365-42696387 AAATTAATGCTGGAGGTGGGGGG - Intronic
1179786883 21:43735244-43735266 AAATAAATCCTAAAGGAGGATGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951523846 3:23634264-23634286 AAAAATGTTCTAAAAGTGGGTGG - Intergenic
951667789 3:25146394-25146416 CAATATATGTTAAAGGGGGCAGG + Intergenic
951841980 3:27044167-27044189 CAAAATATGTTAAAGGTGGAGGG + Intergenic
953906495 3:46870938-46870960 GGATATATGGTAAAGGTGTGTGG - Intronic
955222143 3:57031969-57031991 AAATATATACTAAAAGATGGGGG + Intronic
957734664 3:84189918-84189940 AAGTATATGCATCAGGTGGGAGG + Intergenic
958693629 3:97500383-97500405 AAATATATAGTAATGGTGGAAGG + Intronic
959485547 3:106924684-106924706 AAATATATGCATCAGGTGGGAGG + Intergenic
959616471 3:108353759-108353781 AAAGTGGTGCTAAAGGTGGGAGG + Exonic
960474821 3:118110841-118110863 ATTTGTGTGCTAAAGGTGGGTGG - Intergenic
963234866 3:142946790-142946812 GATTGTATGCTAAACGTGGGGGG + Intergenic
963395134 3:144722583-144722605 AAATATATGATAAAGTTGTGGGG - Intergenic
963575732 3:147059160-147059182 CAAAATATGTTAATGGTGGGGGG - Intergenic
965094087 3:164200461-164200483 AAATAAAAGCTAAAAGTAGGTGG + Intergenic
965569209 3:170154088-170154110 AAATATATGCTAAAAGTATATGG - Intronic
966166713 3:177027520-177027542 AAATATATGCTTCAGGTGTTCGG + Intronic
966397875 3:179520607-179520629 AAGTATATGCGTCAGGTGGGAGG - Intergenic
972978964 4:44672260-44672282 ATATAAATGTTAAAGGTGGTGGG + Intronic
973751335 4:54023393-54023415 AAGTATATGCATCAGGTGGGAGG - Intronic
976736853 4:88318879-88318901 AAACATAAGCTCAAGGTGGTTGG - Intergenic
977905138 4:102468346-102468368 AAATATATGCTCCATGTGAGGGG + Intergenic
978648051 4:110965024-110965046 AAATATGTTTTAAAGGTGTGGGG + Intergenic
978719266 4:111887887-111887909 AAATCTAAGCTAAATGTGGAAGG + Intergenic
978845951 4:113272816-113272838 CAAAATTTGATAAAGGTGGGTGG - Intronic
978950141 4:114548310-114548332 TAACATATGCTCAAGGTGGTTGG + Intergenic
980071402 4:128246274-128246296 TGATATATGCTCAAGGTGGTAGG + Intergenic
980111691 4:128642828-128642850 AAATATGTGCGTCAGGTGGGAGG + Intergenic
981420780 4:144548052-144548074 AAACATTTGCTAAAAGTTGGTGG - Intergenic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987968758 5:24913615-24913637 AAATATATGCAATAGGTGAAAGG + Intergenic
988074408 5:26334435-26334457 AAAAAAATGCTAAGTGTGGGAGG + Intergenic
989490561 5:42047894-42047916 AAACATGTACCAAAGGTGGGGGG + Intergenic
989554911 5:42782724-42782746 AAATATATGTTAAATATGTGAGG - Intronic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
992925136 5:81575523-81575545 AAAAACAAGCTAATGGTGGGAGG + Intronic
993249628 5:85503113-85503135 AGATGTATGAGAAAGGTGGGGGG - Intergenic
993299083 5:86184237-86184259 AAATATGTGCTTGAGGTGGTTGG - Intergenic
993649095 5:90496259-90496281 AAATGTATATTAAGGGTGGGGGG - Intronic
993668001 5:90724523-90724545 AAATAAATACTAAATGTGGCTGG - Intronic
995066969 5:107873427-107873449 AAATATATGATAAAAATTGGAGG + Intronic
995233247 5:109795281-109795303 ATAGAAATGCTAAGGGTGGGAGG - Intronic
995414719 5:111896241-111896263 GAATAGATTCTAGAGGTGGGAGG + Intronic
995949120 5:117688425-117688447 AAATATTAGCTGAACGTGGGTGG - Intergenic
996574763 5:124968572-124968594 AAATATATGCGTCAGGTGTGAGG + Intergenic
996583656 5:125060358-125060380 AAAGATACCCTAAATGTGGGTGG + Intergenic
996626636 5:125577903-125577925 AAATATTTCCTAAAGGTGGTAGG - Intergenic
997364369 5:133316296-133316318 AAATAGAGGCTAAAGGTGGCTGG + Intronic
997678583 5:135733486-135733508 AAGTATATGCATCAGGTGGGAGG + Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
999223056 5:149997629-149997651 AAGTATATGACAAAGGTGGGTGG + Intronic
999613064 5:153391780-153391802 AAAGATAACCTAGAGGTGGGAGG - Intergenic
999845356 5:155473630-155473652 AAATATAAGGAAAAGGTAGGAGG + Intergenic
1000519182 5:162277365-162277387 AAGTATATGCATCAGGTGGGAGG + Intergenic
1001331228 5:170764007-170764029 AAGTATATGCGTCAGGTGGGAGG + Intronic
1002362106 5:178680509-178680531 TAATAAATGCTAAAGGAGGCTGG - Intergenic
1002428510 5:179189726-179189748 AAATATCTTCTTAAGGTAGGGGG + Intronic
1002554356 5:180023465-180023487 AAATATATGCAAAAGGAGCCTGG + Intronic
1002981364 6:2141950-2141972 AAATGTATGCTATAGGAGCGGGG - Intronic
1004837258 6:19542863-19542885 AAGTATATGCGTCAGGTGGGAGG - Intergenic
1005793161 6:29328288-29328310 ATATATATGATAAAGGTTGATGG - Intergenic
1006464998 6:34188136-34188158 AAAGATATGCTAAAGTTTTGGGG - Intergenic
1008300191 6:49828052-49828074 AAATATATTGTTAAAGTGGGAGG + Intergenic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1010729130 6:79369146-79369168 AAAAATATGCGAAAGCTGTGAGG + Intergenic
1010790829 6:80063096-80063118 AAATAAAAAATAAAGGTGGGAGG - Intergenic
1011159359 6:84370750-84370772 AAATAGAGGATTAAGGTGGGGGG + Intergenic
1011829979 6:91359758-91359780 AACTTTATGGTAAAGATGGGAGG + Intergenic
1012492431 6:99797215-99797237 AAAGATAGGCTAAAAGTGAGTGG + Intergenic
1012796289 6:103766175-103766197 AAATAAATGCTACAGGTTGAAGG + Intergenic
1014115067 6:117661303-117661325 AAATATATGCATCAGGTGTGAGG + Intergenic
1015223508 6:130830892-130830914 GATTATATGCTAAACGCGGGGGG - Intronic
1015502496 6:133948849-133948871 AAATGTATGTTAAAGGTGTAGGG + Intergenic
1017859935 6:158387022-158387044 AAATAGATGATAAAATTGGGGGG + Intronic
1018449132 6:163890213-163890235 AAATATATGCCACACGTAGGTGG + Intergenic
1019986574 7:4660809-4660831 AATTATATTCCAAAGGTGAGAGG + Intergenic
1020246199 7:6431473-6431495 AAAGATATGATAAATGTGGCCGG + Intronic
1020540881 7:9460300-9460322 AAATATATGCATCAGGTGTGAGG + Intergenic
1021172939 7:17417834-17417856 AAATATATGCATCAGGTGTGAGG - Intergenic
1021707146 7:23379067-23379089 AAACAAATGCTAATGGAGGGAGG - Intronic
1022018140 7:26371171-26371193 ATATATATGGTAAAGTTGGCTGG + Intronic
1026119471 7:67524306-67524328 GATTATATGCTAAATGGGGGTGG + Intergenic
1026243877 7:68600936-68600958 CAATTTATGCTCAAGGTGAGAGG - Intergenic
1026250403 7:68665088-68665110 AAATAAATGCACAAGCTGGGAGG - Intergenic
1027932657 7:84558262-84558284 ATATATATGCTACTGTTGGGTGG - Intergenic
1028204933 7:88005603-88005625 ACACAGATGCTTAAGGTGGGTGG + Intronic
1028415180 7:90572582-90572604 AAATATGTGCTAAAAATGGGAGG - Intronic
1029846905 7:103421076-103421098 AAAGATATTTTCAAGGTGGGTGG + Intronic
1033723298 7:144084785-144084807 CAAAATATGCTAACGGTGGAGGG + Intergenic
1036475234 8:9087202-9087224 AAAAATAAGATGAAGGTGGGGGG - Intronic
1037879885 8:22567350-22567372 AAATGTTTGCTAAATGAGGGTGG + Intronic
1039836907 8:41263858-41263880 AAATATATGTAAAAAGTGCGGGG + Exonic
1041607464 8:59799597-59799619 CAAAATATGCTAATGGTGGAGGG - Intergenic
1043292517 8:78620691-78620713 AAATATCAGCCAAGGGTGGGAGG - Intergenic
1043457588 8:80427802-80427824 AAAAAAATGCTGAAGATGGGAGG + Intergenic
1044910158 8:97049263-97049285 AAATATCTGCTGAAGGAAGGAGG - Intronic
1045497362 8:102719728-102719750 AAACACATGCTGAAAGTGGGGGG + Intergenic
1045634192 8:104164073-104164095 AAGGATTTGATAAAGGTGGGTGG - Intronic
1046232913 8:111381029-111381051 AAATAAATGCTATTAGTGGGGGG + Intergenic
1046294343 8:112199571-112199593 AATTATATGCGTCAGGTGGGAGG - Intergenic
1047871838 8:129091566-129091588 AAATAGATGGTAAAGATGAGAGG - Intergenic
1048983956 8:139720485-139720507 AACTAAATTCTAAAGGTGGAAGG + Intergenic
1050802549 9:9633662-9633684 AAATATTTTCTAAAGGTTGTAGG + Intronic
1050872234 9:10587243-10587265 AAATTTATCCTAAAGGAGGCAGG - Intronic
1051129596 9:13845023-13845045 CAATATATTCTAAAGTTAGGTGG - Intergenic
1051250011 9:15150105-15150127 AAATAGATTCTAAAGCTGAGAGG - Intergenic
1051474558 9:17490843-17490865 AAATCTCTGCTATTGGTGGGGGG - Intronic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1052653566 9:31330153-31330175 AAGTATATGCATCAGGTGGGAGG - Intergenic
1053017231 9:34669158-34669180 CAACACATGCTAAAGGTGGTCGG - Intergenic
1053140477 9:35679685-35679707 AAATGTATCCTAAAGATGGTAGG - Intronic
1053673771 9:40399569-40399591 AAACATATGATAAAGGCAGGAGG - Intergenic
1053923574 9:43025929-43025951 AAACATATGATAAAGGCAGGAGG - Intergenic
1054384876 9:64539634-64539656 AAACATATGATAAAGGCAGGAGG - Intergenic
1054510856 9:65976721-65976743 AAACATATGATAAAGGCAGGAGG + Intergenic
1054807225 9:69406503-69406525 AAGTATATGCAACAGGTGTGAGG + Intergenic
1055589153 9:77791807-77791829 AAATATATACCAAGGGAGGGAGG + Intronic
1055679550 9:78701196-78701218 AAAGAAATGCTAAAGGGGTGAGG - Intergenic
1055834778 9:80425963-80425985 ATAATTATGCTAAAGGAGGGGGG + Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1059685159 9:116628098-116628120 CAATATCTGCTAAAGGTGGGTGG - Intronic
1059759880 9:117327732-117327754 AAATATTTGTTGAAGGAGGGAGG - Intronic
1186834830 X:13427424-13427446 ATAAATGGGCTAAAGGTGGGGGG + Intergenic
1188185308 X:27107351-27107373 AAGTATATTCTTAAGTTGGGTGG - Intergenic
1188244664 X:27825249-27825271 GAATCCAGGCTAAAGGTGGGAGG - Intergenic
1188332787 X:28894581-28894603 AAGTATATGCGTCAGGTGGGAGG + Intronic
1188361453 X:29259917-29259939 AAAAATATAATAATGGTGGGGGG - Intronic
1188657783 X:32718824-32718846 AAATATATGGCAAATGTGGATGG + Intronic
1189956615 X:46281974-46281996 GAAAATATTCTAAAAGTGGGTGG + Intergenic
1192130360 X:68543940-68543962 TAAAATAGTCTAAAGGTGGGAGG + Intergenic
1192672398 X:73159295-73159317 CAAAATATGTTAAAGGTGGAGGG + Intergenic
1192706375 X:73531425-73531447 AAGTATATGCGTCAGGTGGGAGG - Intergenic
1193662080 X:84269565-84269587 TAATATATGTTGAAGGTGGGAGG + Intergenic
1195564951 X:106330094-106330116 AAATATATGGCAAAGGTGATGGG - Intergenic
1195576738 X:106460184-106460206 AAATATATGGCAAAGGTGATGGG - Intergenic
1197273352 X:124449889-124449911 AGTTGTATGCTCAAGGTGGGTGG + Intronic
1200103073 X:153697878-153697900 AAATAAATTCTAGAGGTGGATGG + Intergenic
1201755237 Y:17480052-17480074 ATATATATATTAAAGGTGGATGG - Intergenic
1201846315 Y:18425933-18425955 ATATATATATTAAAGGTGGATGG + Intergenic