ID: 1051790117

View in Genome Browser
Species Human (GRCh38)
Location 9:20792454-20792476
Sequence ATGGGGATACGTTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051790117 Original CRISPR ATGGGGATACGTTTTGAGGA AGG (reversed) Intronic
901592729 1:10359170-10359192 ATGGGGATGTGTTTAGAGGGAGG + Intronic
905378456 1:37541730-37541752 AGGGGGATACATTTTAAGTATGG + Intronic
906214134 1:44029528-44029550 ATTGGGATAGGTTTTGAGGATGG - Intronic
908111270 1:60900827-60900849 ACAGGGATACGTTCTGAGAAAGG - Intronic
908846766 1:68332621-68332643 ATTGAGATACATTTTCAGGAAGG - Intergenic
911040698 1:93588732-93588754 ATGGGGATACCTTGTGAAGGGGG - Intronic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
915616470 1:157043356-157043378 ATGGGGAGAAGCGTTGAGGAGGG + Intronic
916615535 1:166435421-166435443 ATGGGGATGAGGTTTGAGGGAGG - Intergenic
918396652 1:184120015-184120037 TTTGGGATATGTTTTGGGGAAGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
922506987 1:226132387-226132409 ATGAGGATACGTTGGGAGTAGGG - Intergenic
924857151 1:247884878-247884900 ATGGGGATGTGTTCTGAGAAAGG + Intergenic
1064032576 10:11892429-11892451 ATGGAAGTACGTGTTGAGGATGG - Intergenic
1068835065 10:61544309-61544331 ATGGGCTTACTTTTTGATGAGGG - Intergenic
1069073074 10:64010053-64010075 ATGGGCATACGATGTGAGTAGGG - Intergenic
1069137328 10:64782299-64782321 GTGGGGATCCATATTGAGGACGG + Intergenic
1074204226 10:111268199-111268221 TTGGAGATACTTTGTGAGGAGGG + Intergenic
1075221339 10:120587622-120587644 AACGGGATAATTTTTGAGGACGG - Intronic
1075912037 10:126133033-126133055 ATCAGGATAGGATTTGAGGATGG - Intronic
1075968251 10:126631352-126631374 ATCTGCAAACGTTTTGAGGAAGG - Intronic
1077483139 11:2825934-2825956 ATGGGGACAGGATCTGAGGAAGG - Intronic
1079985553 11:27196968-27196990 ATGGTGATATTCTTTGAGGAGGG + Intergenic
1081719093 11:45273477-45273499 ATGGGGATAGGCTTGGAGCAGGG + Intronic
1088025968 11:105183693-105183715 ATGAACATACCTTTTGAGGAGGG - Intergenic
1088391489 11:109319708-109319730 AGGGTGATAACTTTTGAGGATGG + Intergenic
1089583690 11:119496927-119496949 ATGGGGATGAGTCTAGAGGAGGG - Intergenic
1090302459 11:125655783-125655805 TTGGGGATATGTTTTGAAGCTGG - Exonic
1090342004 11:126032277-126032299 AGAGGGATACGTTTGGGGGATGG + Intronic
1091455635 12:605350-605372 CTGGGGATAGGTGTTGGGGAAGG - Intronic
1091798351 12:3309792-3309814 ATGGGGAGAGGTGTGGAGGAAGG + Intergenic
1093286200 12:17267380-17267402 ATGGGGATATGTTCTGAGAAAGG - Intergenic
1096780987 12:53991989-53992011 ATTGGGATAGGTTGAGAGGACGG - Intronic
1100492091 12:95090553-95090575 ATGGGTATAGGTGATGAGGAAGG + Intronic
1100597491 12:96084271-96084293 AAGGGGATTCGTTTTAAGGAAGG + Intergenic
1101720705 12:107348117-107348139 ATGGGGAGACTTTCTGAGTAAGG - Intronic
1108117218 13:47142415-47142437 ATGAGGATACTTTTAGAGAAAGG - Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1114861223 14:26525604-26525626 CTGGAAATATGTTTTGAGGAAGG - Intronic
1116120290 14:40714411-40714433 ATGGAGATATGTTCTGAGTAAGG - Intergenic
1117164232 14:53017847-53017869 ATGGGGCCATATTTTGAGGAGGG - Intergenic
1118911072 14:70062627-70062649 ATAAGGATACATTCTGAGGAAGG - Intronic
1122197194 14:100097353-100097375 ATGGGGATGGGGTTTGAAGAAGG - Intronic
1122588714 14:102829706-102829728 ATGGGGATTGGTTTTGGGGAGGG + Intronic
1124996808 15:34731644-34731666 ATGGTAATAGGGTTTGAGGAAGG + Intergenic
1130743199 15:86623238-86623260 ATGGGGACGGGTTTGGAGGAAGG + Intronic
1131025156 15:89134838-89134860 ATGGGGTCAAGTTTTGAGTATGG + Intronic
1132350360 15:101135910-101135932 ATGGGCATACGTTCTGAGAAAGG + Intergenic
1137261810 16:46836749-46836771 ATGGGGAAATGTTCTGAGAAAGG - Intergenic
1140183117 16:72740385-72740407 AAGGGGGTAGGTTTTGAGTAGGG + Intergenic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143924461 17:10357566-10357588 ATTGTGATACACTTTGAGGAAGG - Intronic
1145350225 17:22075325-22075347 TCGTGGATAAGTTTTGAGGAAGG - Intergenic
1147004597 17:37392259-37392281 TTGGGGATAACTTATGAGGAAGG - Exonic
1147194161 17:38754029-38754051 ACGGTGATAGGTTTTCAGGAGGG + Intronic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1157176878 18:45459936-45459958 ATGGGCTAAGGTTTTGAGGAAGG - Intronic
1165565693 19:36725539-36725561 ACGGTGTTACGTTTTGGGGATGG + Intronic
1167148327 19:47695289-47695311 ATGGGGCTCCCGTTTGAGGAGGG + Intronic
1168487600 19:56777786-56777808 ATGGGGGGAGGTTTTGAGCAGGG - Intronic
926104957 2:10144202-10144224 CTGGGGCTCTGTTTTGAGGACGG + Intronic
926775307 2:16416345-16416367 ATGGAGATTCTTTTTTAGGAAGG + Intergenic
927298928 2:21488023-21488045 ATGGGGGTGGGTTGTGAGGAGGG - Intergenic
927442836 2:23131425-23131447 ACCGGGATGCGCTTTGAGGAAGG + Intergenic
928179837 2:29061222-29061244 CTGGGCATACGATGTGAGGAAGG + Exonic
928706953 2:33960273-33960295 ATGGGGATGGATTTTGAGAAGGG - Intergenic
929932444 2:46269419-46269441 AGGGGAATAAGTTTTGAGGCTGG + Intergenic
938932206 2:136096693-136096715 ATGTGGATATGTTTTTAGAATGG + Intergenic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
943610912 2:190033519-190033541 ATGGGCATAACTTGTGAGGATGG + Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
1170336716 20:15278239-15278261 TTAGGGATAGGTTATGAGGAAGG + Intronic
1171494037 20:25542258-25542280 ATGGGAATACCTTTTGGGAAGGG + Intronic
1171560483 20:26120313-26120335 TCGTGGATAAGTTTTGAGGAAGG - Intergenic
1173236856 20:41254207-41254229 ATAGGGATAGGATTTGAGAAGGG - Intronic
1174277614 20:49415188-49415210 ATGGGGATACGTCTTGTGGGTGG - Intronic
1174468481 20:50736563-50736585 ACTGGGACACTTTTTGAGGAAGG + Intronic
1174605631 20:51759306-51759328 ATAGGGGTATGTTTTGAGGGAGG - Intronic
1174649883 20:52115741-52115763 AAGGGGAGAAGTTTGGAGGAAGG + Intronic
1174893312 20:54421730-54421752 ATGGGCACTGGTTTTGAGGAGGG - Intergenic
1175166811 20:57049680-57049702 ATGGGGATCTGCATTGAGGATGG + Intergenic
1179352331 21:40624014-40624036 ATGGCGATAAGTCTTGAGGATGG + Intronic
1181176488 22:21040009-21040031 ATAGGGCCAAGTTTTGAGGAGGG - Intergenic
949098519 3:114849-114871 ATTGGGATACATTTCGAGGGTGG + Intergenic
949126345 3:449499-449521 ATGGGGATTCATTCTGAGAAAGG + Intergenic
949219521 3:1614250-1614272 GTGGGGATAAGGTTTGAGTAGGG - Intergenic
950104466 3:10379415-10379437 GTGGGGATACGGGTTGGGGAGGG + Intronic
951633841 3:24751557-24751579 ATGGAGATGCTTTTTCAGGAAGG + Intergenic
960138311 3:114127973-114127995 ATGGGGATATTTTCTGAAGACGG - Intergenic
962147912 3:132860329-132860351 CTGGGGATATGATTAGAGGAAGG + Intergenic
962433454 3:135342443-135342465 ATTTTGATACTTTTTGAGGAAGG - Intergenic
965337410 3:167443934-167443956 ATGGGGGTACCTATTTAGGAAGG - Intronic
965633728 3:170759583-170759605 TTGGGGAGACCTTCTGAGGAAGG - Intronic
970797590 4:19932000-19932022 ACGGGGATATGTTCTGAGAAAGG + Intergenic
971360097 4:25930132-25930154 ATGATGAGACATTTTGAGGATGG + Intergenic
976192498 4:82501486-82501508 AATGGGATACGCTTTGGGGATGG + Intronic
977976338 4:103270978-103271000 ATGGGGATCCATTTTCATGAAGG - Intergenic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
990090564 5:52041757-52041779 AGGGGGATAGGTGTTGAGGGTGG - Intronic
994025168 5:95073570-95073592 TTGGGGAAACCTTTTGAGTATGG - Intronic
994687136 5:102969467-102969489 ATGGGGGTCCTTTCTGAGGAAGG + Intronic
994837469 5:104874028-104874050 ATGGGGATACTTTCTGAAAAAGG - Intergenic
995256199 5:110049606-110049628 GTAGGGATAGGTTGTGAGGAAGG + Intergenic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
997993569 5:138567055-138567077 ATGGGGATACCTTCTTAGGTGGG - Exonic
999622221 5:153485170-153485192 ATGGGCAGATGTTTTGAGGGTGG + Intergenic
1007079338 6:39087629-39087651 CTGGGGAAAGGTTTTGGGGAGGG - Exonic
1007521818 6:42455879-42455901 ATGGGGATAAGTGCTGAGAATGG - Intergenic
1007941674 6:45787318-45787340 GAGGGGGTACATTTTGAGGAAGG + Intergenic
1009035516 6:58113120-58113142 CTGGGTATACGTTTTGGGGGAGG + Intergenic
1010422368 6:75689855-75689877 ATGGGGTTATGTTCTGAGAAAGG - Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1015232157 6:130927584-130927606 GAGGGCATTCGTTTTGAGGATGG - Intronic
1015424382 6:133049117-133049139 GTGGGTATACGTTCTGAGAAAGG - Intergenic
1015518093 6:134104091-134104113 ATGGGCATGCGCTTGGAGGAAGG + Intergenic
1015603649 6:134934458-134934480 ATGGTGATCAGTTTTTAGGAAGG - Intronic
1015675805 6:135747113-135747135 ATGGGGATATGTTCTGAGAAAGG + Intergenic
1015759901 6:136647622-136647644 AAGGGGAAACGTGTTGAGGGAGG - Intronic
1016878251 6:148884921-148884943 AATGGGACACGTTTGGAGGAAGG + Intronic
1016990455 6:149924783-149924805 TTGGGGTTTCCTTTTGAGGATGG - Intergenic
1017204686 6:151791938-151791960 ATGGGGATGAGTTTGGAGGAAGG + Intronic
1018739384 6:166715562-166715584 ACGGGGATACGTTCTGAGAAAGG + Intronic
1020682380 7:11253398-11253420 ATGGGCATTCCTTTTGTGGAAGG + Intergenic
1022725450 7:32977299-32977321 ATGGGGATATGTTCTGAGAAAGG + Intronic
1022800729 7:33774856-33774878 ATGGAGATCCTTTTGGAGGAAGG + Intergenic
1022984397 7:35636724-35636746 ATGGGGAAAGGTCTGGAGGAAGG + Intronic
1024679362 7:51668471-51668493 ATAAGGACACATTTTGAGGAGGG + Intergenic
1025048163 7:55710517-55710539 ATGGGGATATGTTCTGCGAAAGG - Intergenic
1025277350 7:57595051-57595073 TCGTGGATAAGTTTTGAGGAAGG + Intergenic
1026375487 7:69746411-69746433 ATGGTGATACATTCTGTGGAGGG + Intronic
1028977291 7:96928374-96928396 ATCAGGATACGTTCTGAGAAAGG - Intergenic
1031013155 7:116544957-116544979 AAGCGTCTACGTTTTGAGGATGG - Intronic
1031117513 7:117683916-117683938 ATATGGATTCTTTTTGAGGATGG - Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032414603 7:131726328-131726350 ATGGGGATAGGCTTGGAAGAGGG + Intergenic
1038249667 8:25891417-25891439 ATGTGTAGACCTTTTGAGGAAGG + Intronic
1039043278 8:33427778-33427800 TTGGGGATAGCTTTTGAAGATGG - Intronic
1039171691 8:34754472-34754494 AAGGGGATATGTTTTCAGTAGGG + Intergenic
1044356364 8:91226755-91226777 ATGGGAATACTTTTTATGGAGGG + Intronic
1046815192 8:118575606-118575628 ATGGGGATACATTTTTATAAAGG + Intronic
1047993182 8:130307965-130307987 ATGGAGACAACTTTTGAGGAAGG - Intronic
1050256082 9:3793613-3793635 ATGGGAACATGTTTTGGGGAGGG - Intergenic
1050859443 9:10407923-10407945 ATGGGGAAACTTTTGGAAGAAGG + Intronic
1051790117 9:20792454-20792476 ATGGGGATACGTTTTGAGGAAGG - Intronic
1052524097 9:29590723-29590745 ATGGGGATCAGTTCTCAGGATGG - Intergenic
1057269424 9:93641030-93641052 ATGGTGGTAGGTTTTGGGGAGGG + Intronic
1059200295 9:112408491-112408513 ATGGGGATATGTTCTGAGAAAGG + Intronic
1203628409 Un_KI270750v1:47646-47668 TCGTGGATAAGTTTTGAGGAAGG + Intergenic
1192109800 X:68352381-68352403 ATAGTGATGTGTTTTGAGGAGGG - Intronic
1193661096 X:84259381-84259403 AAGGGGTTACATTTTGGGGACGG + Intergenic
1195126345 X:101813091-101813113 ATGGTGATACCTTCTGAGAAAGG + Intergenic
1195179256 X:102340269-102340291 ATGGCGATACCTTCTGAGAAAGG - Intergenic
1196939050 X:120757803-120757825 ATGGGGATCTAATTTGAGGAAGG + Intergenic
1197759557 X:130018025-130018047 ATGGGAATACCTCTTCAGGAGGG + Intronic
1198337395 X:135679828-135679850 ATGAGGATGGGTTTTCAGGAGGG + Intergenic
1198361796 X:135902986-135903008 ATGAGGATGGGTTTTCAGGAGGG - Intronic