ID: 1051791334

View in Genome Browser
Species Human (GRCh38)
Location 9:20806084-20806106
Sequence TGACATGGCAAGAGTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051791334 Original CRISPR TGACATGGCAAGAGTGGTCC AGG (reversed) Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
904980321 1:34495583-34495605 TGAAGTGACAAGATTGGTCCAGG - Intergenic
915328203 1:155092143-155092165 TGGACTGGCAAGAGGGGTCCAGG + Intergenic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917618392 1:176769366-176769388 CGACATGGCAAGACTCCTCCAGG - Intronic
917927881 1:179804019-179804041 TGACAAGACAAGAGTGGCTCTGG - Intronic
919208478 1:194449863-194449885 TTACATGGCAAGAGTTATGCTGG + Intergenic
922907603 1:229186409-229186431 TGGCTTGGCAAGGGTAGTCCTGG + Intergenic
1067107106 10:43373743-43373765 TGACATGGAGAGAGTGACCCTGG + Exonic
1069412412 10:68167017-68167039 TGACAGAGCAAGACTTGTCCAGG + Intronic
1071162298 10:82762749-82762771 TGACATGGAAAGCTTGGTACAGG - Intronic
1071514383 10:86287524-86287546 TGAGATGTCAGGACTGGTCCTGG - Intronic
1071945309 10:90637416-90637438 TTACATGGCAACAGAGATCCAGG + Intergenic
1072530916 10:96318158-96318180 TAGTATGGCAACAGTGGTCCGGG - Intronic
1075004505 10:118820370-118820392 TGGCCTGGCAAGAGTAGTCGGGG + Intergenic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG + Intronic
1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG + Intronic
1080975705 11:37337679-37337701 TCACATGGCAAAAGTGGTCAGGG + Intergenic
1084444377 11:69195193-69195215 TGATATGGCAATAGTGGTGATGG + Intergenic
1085206370 11:74734931-74734953 TAATATGGCATGAGGGGTCCCGG - Intergenic
1085764576 11:79271676-79271698 TGAACTTGCCAGAGTGGTCCTGG + Intronic
1088977319 11:114827401-114827423 TTAGATGGCAAGTGCGGTCCTGG + Intergenic
1089101457 11:115966035-115966057 TGACATGACAGGAGTGGCCCTGG + Intergenic
1090808461 11:130217470-130217492 TGACCTGGCGAGAGAGGTCCTGG - Intergenic
1092007096 12:5078877-5078899 TGGGATGGCAGGAGTGGTCTGGG - Intergenic
1097961495 12:65535864-65535886 TGACTTGGCAAGATTAGTTCAGG - Intergenic
1104630598 12:130398316-130398338 TCACATGGCAAGAGTTGCTCTGG - Exonic
1105583221 13:21720561-21720583 TGACATGGCAAGAGAGATAGAGG - Intergenic
1106150883 13:27100560-27100582 TGACATGTCAAGGTTGGTGCAGG - Intronic
1107738932 13:43428423-43428445 TGACATGGGGAGAATGGACCTGG - Intronic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1117726657 14:58681451-58681473 TGAGAAGTCAAGAGTGGTGCTGG + Intergenic
1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG + Intronic
1119858997 14:77923294-77923316 GGAGATGGCAAGAATGCTCCTGG + Intronic
1123804949 15:23861048-23861070 TGACAGGGCATGAGTGGACCAGG - Intergenic
1124353743 15:28979314-28979336 TCACATGACAGGAGTGGACCGGG - Intronic
1129672678 15:77615975-77615997 TGACAGGGCAGGAGGGGCCCAGG - Intronic
1130776744 15:86992139-86992161 TCACATGGCAAGAGTGAACAAGG + Intronic
1133022049 16:2971059-2971081 GGACAGGGCAAGACAGGTCCAGG - Intronic
1133157179 16:3883325-3883347 GGACATGGCAAGTCTGGGCCTGG + Intergenic
1133264631 16:4575783-4575805 TGATATGGCTGGAGTGGTCGAGG - Exonic
1135885314 16:26300763-26300785 TGACATGGGAAGAAAGGTCATGG + Intergenic
1136546816 16:30959120-30959142 TGACATGGCAACGGGGGTCTTGG - Exonic
1137589083 16:49682442-49682464 TGGCATTGCAAGTGTGGACCGGG - Intronic
1138657677 16:58500409-58500431 AGACACGGCCAGAGTGCTCCAGG + Intronic
1139595355 16:67954604-67954626 GGACATGGCCAGAGTTGGCCAGG + Intronic
1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG + Intergenic
1142511103 17:393978-394000 AGCCAGGGCAAGAGTGTTCCAGG + Intergenic
1146711390 17:35044788-35044810 TGAGGTGGCAACAGTGCTCCAGG - Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150005684 17:61467639-61467661 TTACATGGCCAAAGGGGTCCAGG - Exonic
1152760075 17:82103198-82103220 TGAGATGGGAAGAGGGGCCCAGG - Intronic
1154377564 18:13822685-13822707 TGGCATGGCATGTGTAGTCCTGG + Intergenic
1158291873 18:55952793-55952815 GGACAGGGAAAGAGTGGTTCTGG + Intergenic
1160348484 18:78153887-78153909 TCACATGGCAGGAGGGGCCCGGG + Intergenic
1161150889 19:2708430-2708452 TGACATAGCGATTGTGGTCCTGG - Intergenic
1161582480 19:5088384-5088406 TGATATGGCCTGCGTGGTCCAGG - Intronic
1162251344 19:9446342-9446364 TGACTTGGCAAAATTGGTTCTGG - Intergenic
1164237206 19:23347636-23347658 TGACATGGAAAGAGTTGTGGAGG - Intronic
1167116704 19:47492820-47492842 TGACATGGCAAGGGATGTCGGGG + Intronic
1168128675 19:54302427-54302449 TGAGAAGGGAAGAGAGGTCCAGG - Intergenic
1168158569 19:54492821-54492843 TGCCATGCCAAGACTGGTCAAGG - Intergenic
925188930 2:1867581-1867603 GCAGATGCCAAGAGTGGTCCTGG + Intronic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
928893489 2:36234534-36234556 AGATATGTCAAGAGTGTTCCAGG - Intergenic
929533904 2:42768670-42768692 TGGGAGGGCAAGAGTGGTGCAGG - Intronic
930132595 2:47868090-47868112 TGACATGGCAGTAGTTGTCCAGG - Intronic
933254231 2:80062497-80062519 TGACATTGCAATAATGCTCCTGG + Intronic
933951599 2:87335131-87335153 TGACTTGACAAAAGTGGTGCAGG - Intergenic
934129586 2:88935315-88935337 TGACTTGACAAAAGTGGTGCAGG + Intergenic
934235844 2:90231441-90231463 TGACTTGACAAAAGTGGTGCAGG - Intergenic
937442439 2:121928171-121928193 TGATGTAGCAAGAGTGGACCTGG + Intergenic
937695205 2:124801111-124801133 GGAGATGGCAAGAGATGTCCAGG - Intronic
938159602 2:128973463-128973485 TGACATGGCCACAGAGGCCCTGG - Intergenic
938324515 2:130389567-130389589 TGACAAAGCTAGAGTGCTCCAGG + Intergenic
938712760 2:133989782-133989804 TGACATGGAAACAGTGCTCATGG + Intergenic
940094360 2:149957394-149957416 TCACATGGCAAGAGTGTTCATGG - Intergenic
940488291 2:154324711-154324733 GGAAATAGAAAGAGTGGTCCTGG + Intronic
941982533 2:171474913-171474935 AGACAGCGCAAGAGTGATCCTGG - Intronic
944128092 2:196317123-196317145 TGACATAGCAGGTGTAGTCCGGG - Intronic
944382523 2:199127955-199127977 AGACATGGAAAGAGTCTTCCTGG - Intergenic
945497804 2:210531044-210531066 TGACATGGCAAGAGTTTTTAGGG - Intronic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
948237112 2:236399651-236399673 TGACCAGGCATGGGTGGTCCAGG + Intronic
949050439 2:241894935-241894957 TGGCCTGGTCAGAGTGGTCCAGG + Intronic
1170405526 20:16031976-16031998 TAACATGGAAAGAGTTGTTCAGG + Intronic
1170979324 20:21196242-21196264 TGACAGGGTAAGAGTGGTGTGGG - Intronic
1171115539 20:22521975-22521997 TGCCAAGGCTAGAGTGCTCCAGG - Intergenic
1175571805 20:60028680-60028702 TGACATGGCAAGTGAGGTTGTGG + Intronic
1179923641 21:44520988-44521010 TCACGTGGCAAGAGTGGCCTGGG + Intronic
1182907726 22:33952515-33952537 TGACATGCTCAGAGTGGCCCCGG + Intergenic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
952416172 3:33093151-33093173 TGCCATGGCCAGAGTAGTGCAGG + Exonic
953516559 3:43598163-43598185 GGAAATGGAAAGAGTGCTCCAGG + Intronic
954676642 3:52319536-52319558 TGAGATGGCAGGGGTGGCCCTGG - Intronic
956936349 3:74106293-74106315 TGACAGAGCAAGACTAGTCCTGG - Intergenic
956949010 3:74258356-74258378 TGACCTGGCAAGTCTGGTCTAGG - Intergenic
958022834 3:88017030-88017052 TTACATCTCAAGGGTGGTCCAGG + Intergenic
958580158 3:96007786-96007808 TGACATGGCAATGGTGGTAGTGG - Intergenic
961942123 3:130649112-130649134 TGACATCCCGGGAGTGGTCCAGG - Exonic
963761393 3:149289836-149289858 TGACAGTGTAAGATTGGTCCAGG + Intergenic
963987200 3:151610062-151610084 TGACAGGGCAACAGTGGTGATGG + Intergenic
964313666 3:155420642-155420664 TGACTTGGCAAGAATGGTTGGGG - Intronic
966419463 3:179723116-179723138 TGACATGCCAGGAATAGTCCAGG + Intronic
966672835 3:182547798-182547820 TGACATGACAAGAGCTTTCCAGG - Intergenic
970966733 4:21936598-21936620 TTACCGGGCAAGAATGGTCCAGG + Intronic
974012309 4:56618052-56618074 TTACATGGCCAGGGTGGTCTTGG + Intergenic
976867365 4:89745893-89745915 TGACATTTAAAGAGAGGTCCAGG - Intronic
977588434 4:98800877-98800899 TGACAGCACATGAGTGGTCCTGG + Intergenic
986164844 5:5264613-5264635 TGTGATTGCAAGAGGGGTCCTGG - Intronic
989172246 5:38483929-38483951 TCACCTGGCAAGAGCTGTCCTGG - Intronic
989239681 5:39189582-39189604 TAAAATGGAAAGAGTGGTTCTGG + Intronic
992201921 5:74393310-74393332 TGACATATCATGAGTGGACCTGG - Intergenic
993264989 5:85714513-85714535 TGATATAGCAAGAATGGTACTGG - Intergenic
994457116 5:100024986-100025008 TGGCAAGGGAAGAGTGGTCAGGG + Intergenic
998188908 5:140005591-140005613 AGCCATGGCAAGAGTGCTCGTGG + Intronic
999730210 5:154471486-154471508 TGACAGGGGAAGAGGGTTCCAGG + Intergenic
1000638870 5:163677225-163677247 TGACAGGGCAAGACTGCTTCTGG + Intergenic
1004697473 6:18047084-18047106 TGACATGGTGTGAGTGGTACAGG + Intergenic
1005957709 6:30676262-30676284 TGACATGTCAAAAGGGGTCTGGG - Intergenic
1008094468 6:47325052-47325074 AGAACTGGCAAGAGTGGGCCGGG - Intergenic
1011241572 6:85277161-85277183 AGACCTGGCAGGAGTGGGCCAGG - Intergenic
1015014240 6:128391063-128391085 TGACAAGGAATGAATGGTCCTGG - Intronic
1015804156 6:137091811-137091833 TCACATGGCAAGAGGGGAGCAGG - Intergenic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1017909750 6:158782591-158782613 TGCCAGGGCAAGAATGCTCCTGG - Intronic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1020573232 7:9892707-9892729 TCAAATGGCAAGAGTAGTCCAGG + Intergenic
1024023550 7:45391896-45391918 TGCCATGGCAAATGTGGCCCAGG - Intergenic
1026921639 7:74159976-74159998 TGACTGGACAGGAGTGGTCCAGG + Intergenic
1027664136 7:81023225-81023247 TGACTGGGGAAGAGTGTTCCAGG - Intergenic
1028906256 7:96157417-96157439 TAACATGGCAAGAGGGATTCGGG - Intronic
1029184226 7:98727155-98727177 TGACATGGCAGGAGTGGGCTGGG - Intergenic
1036479296 8:9124034-9124056 TGGCCTGGCAAGAGTGGTATTGG - Intergenic
1042192598 8:66202880-66202902 TGGCATCTCAAGAGTGTTCCTGG - Intergenic
1043333854 8:79149740-79149762 TGACATGGCAAGAGAGGGGAGGG - Intergenic
1044634022 8:94304450-94304472 TGACATGTCTAACGTGGTCCTGG - Intergenic
1044846312 8:96385356-96385378 TGACTGGGGAAGAGTGGTCTGGG - Intergenic
1045366405 8:101480033-101480055 TCACATGACAAGAATGGTTCAGG - Intergenic
1047868062 8:129051064-129051086 TGATCTGGGAAGAGTGGGCCAGG + Intergenic
1048180392 8:132189168-132189190 GGACATGGCAAAAGTGGACAGGG - Intronic
1048497125 8:134944605-134944627 AGCCACGGCAAGACTGGTCCTGG + Intergenic
1049783948 8:144441685-144441707 GGAGATGGCACGCGTGGTCCAGG - Intronic
1050373300 9:4945032-4945054 TGTCAAAGCAAGAGTGGTTCTGG - Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1053528731 9:38856272-38856294 TGAAATGGGAAGATTGGTCAGGG - Intergenic
1054200958 9:62080705-62080727 TGAAATGGGAAGATTGGTCAGGG - Intergenic
1054637401 9:67507658-67507680 TGAAATGGGAAGATTGGTCAGGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1059110228 9:111550647-111550669 AGACATGGATAGAGTGGCCCAGG - Intronic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1192396580 X:70787622-70787644 CGAAATGGCAAGAGGGGGCCGGG - Intronic
1195129908 X:101841399-101841421 TGACAGGGAAAGAGGGGGCCAGG + Intronic
1195176316 X:102318385-102318407 TGACAGGGAAAGAGGGGGCCAGG - Intronic
1195182548 X:102368708-102368730 TGACAGGGAAAGAGGGGGCCAGG + Intronic