ID: 1051792438

View in Genome Browser
Species Human (GRCh38)
Location 9:20821856-20821878
Sequence TCATCCATGTTATCAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051792438_1051792439 0 Left 1051792438 9:20821856-20821878 CCAGATGCTGATAACATGGATGA 0: 1
1: 1
2: 0
3: 14
4: 109
Right 1051792439 9:20821879-20821901 TTCCTGTTTCAAGTAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051792438 Original CRISPR TCATCCATGTTATCAGCATC TGG (reversed) Intronic
902570811 1:17346104-17346126 TCATCCATGTTCTCCTCCTCAGG - Exonic
907954818 1:59217947-59217969 TCATCCCTTTCCTCAGCATCAGG + Intergenic
908152482 1:61316589-61316611 TCATCAGGGTTATCAGCATTCGG - Intronic
909317229 1:74238748-74238770 TCTTTAATGTCATCAGCATCAGG - Intronic
913234618 1:116768934-116768956 TCAGCCATGTGGTCAACATCTGG + Exonic
916879651 1:169007669-169007691 TCAACCAAGATATAAGCATCAGG - Intergenic
919141408 1:193576731-193576753 TCATACATGTTATCATAGTCGGG - Intergenic
923887848 1:238178538-238178560 TCATCTAAGTCATCAGAATCAGG - Intergenic
923926087 1:238628995-238629017 TCATCCTTGTTATCACCCTATGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924669272 1:246106732-246106754 TCATCAATGTTATCAGCATCTGG + Intronic
924847751 1:247790067-247790089 TACTCCAGGTTTTCAGCATCTGG + Intergenic
1065094883 10:22270764-22270786 TCATCATTATTATCAACATCAGG - Intergenic
1079925085 11:26483879-26483901 TCATTGATGATATCAGTATCAGG - Intronic
1080674245 11:34410207-34410229 ATATCCATCTTTTCAGCATCTGG - Intergenic
1083626924 11:64076697-64076719 TCCTCCATGTTTTCAGGAGCCGG + Intronic
1088634931 11:111810391-111810413 GTATCCATGTTATCAGCAACTGG - Intronic
1090572496 11:128062687-128062709 TCATCCTTCTTATCAGTATAAGG + Intergenic
1094269712 12:28599729-28599751 TCATCCTCCTTATCAGCACCTGG - Intergenic
1094376326 12:29792034-29792056 TCATGCATGTTCTAAGCATGAGG - Intergenic
1098162512 12:67658724-67658746 TCTTTCAGGTTACCAGCATCAGG - Exonic
1100994231 12:100285130-100285152 ACACCCATGTAACCAGCATCCGG + Intronic
1101204691 12:102474962-102474984 CCATCAATGATATCACCATCTGG - Intronic
1104124408 12:125832332-125832354 TCTTGGATGTTCTCAGCATCTGG + Intergenic
1104414059 12:128583547-128583569 TCTTCCCTGTTCCCAGCATCAGG - Intronic
1104414067 12:128583578-128583600 TCTTCCCTGTTCCCAGCATCAGG - Intronic
1104483199 12:129126806-129126828 TCCTCCTTGTTATTAGCATCAGG + Intronic
1108762656 13:53588435-53588457 TCATCTCTGATATCAGAATCTGG + Intergenic
1109420712 13:62107369-62107391 TCATCCATGTTATCACTTTTGGG + Intergenic
1109702553 13:66046591-66046613 TCATCCTTATTCTAAGCATCTGG - Intergenic
1112718068 13:102209615-102209637 TTGTCCATTTTCTCAGCATCTGG + Intronic
1113104126 13:106754717-106754739 TTATCCATGATCTCATCATCCGG + Intergenic
1116178387 14:41504004-41504026 ACATCCTTGTAATCAGCATCTGG + Intergenic
1116378600 14:44234748-44234770 TCATCCATGTTATCACAAAAGGG - Intergenic
1117291414 14:54337444-54337466 CCTTCCGTGTTTTCAGCATCAGG - Intergenic
1118795195 14:69137132-69137154 TCATACAAGTCATCAGCATATGG - Intronic
1120611052 14:86641950-86641972 TCATCCATGTTTTCAACAAATGG - Intergenic
1120684874 14:87526782-87526804 TCATCCTTGTTATAAGGATCAGG - Intergenic
1121333649 14:93063549-93063571 TCATCCATCTCATCACCATCTGG + Intronic
1127344492 15:58080621-58080643 TCATCTAGCTCATCAGCATCCGG + Intronic
1127562372 15:60151980-60152002 GCCTCCAGGTTATCAACATCAGG + Intergenic
1130674483 15:85939806-85939828 TCACCCATCTCATCAGCATGTGG + Intergenic
1137298109 16:47116972-47116994 TCAACCATTTTACCAGTATCAGG - Intronic
1137812875 16:51369852-51369874 TGCTCCATGTTATCATCATCTGG + Intergenic
1139146555 16:64331860-64331882 TCATTCATGTTACCAGCCTCTGG + Intergenic
1139627907 16:68206547-68206569 TCATCCATATTGTAAGCATACGG + Intronic
1140420515 16:74815210-74815232 GCATTCATGTTGTCACCATCAGG + Intergenic
1149573161 17:57690249-57690271 TTTTGCATGTTATCAACATCTGG + Intergenic
1150450231 17:65260607-65260629 TCAACAATGTAATAAGCATCAGG + Intergenic
1153361262 18:4199530-4199552 TCATCCATGTTAATATCTTCTGG + Intronic
1153976798 18:10275484-10275506 TTATCCATGTGATCAGAATGGGG - Intergenic
1155164684 18:23222777-23222799 TCATCCGTGTTAGCACCTTCTGG - Intronic
1158516676 18:58136506-58136528 TCCTCCCTTTCATCAGCATCAGG - Intronic
1160316709 18:77854766-77854788 TCATTCACTTTATCAGCTTCTGG - Intergenic
1160361365 18:78284488-78284510 CCATCCTTGTTATCATTATCAGG - Intergenic
1162152090 19:8653926-8653948 TCATCCATGTAATCAACACCAGG + Intergenic
1167854982 19:52229885-52229907 TCATTCTTATTTTCAGCATCAGG - Intergenic
925475076 2:4204298-4204320 TCATGCATGTCAGCAGTATCTGG + Intergenic
926360099 2:12078760-12078782 CCATCCATCTTTACAGCATCCGG + Intergenic
926661660 2:15473403-15473425 TCATTCATTGTATCATCATCAGG - Intronic
926799830 2:16650469-16650491 TCATCCCTGATATCAGGAACTGG - Intronic
926841209 2:17082435-17082457 TCAAACATGTTAACAGCATTTGG - Intergenic
927454148 2:23234908-23234930 TCATCCAAGTAATCATCATGGGG + Intergenic
928414698 2:31082517-31082539 TAATTCATGTTTTCAGCTTCAGG - Intronic
936273604 2:111071331-111071353 TCCTCCATGTCATCAGCAGCAGG - Intronic
937231207 2:120399078-120399100 GCATCCAGCTTATCATCATCCGG - Intergenic
939943144 2:148376158-148376180 ACACCCATATAATCAGCATCAGG - Intronic
941607556 2:167618877-167618899 TGATCAATGTTAACATCATCAGG - Intergenic
943158082 2:184210558-184210580 TCATTTATGTTTTCAGCAACAGG - Intergenic
943936581 2:193924957-193924979 TCATCCATGTTATCACATTCTGG + Intergenic
944231822 2:197402768-197402790 TCATCCATGTTATCTATATCAGG + Exonic
945681406 2:212918414-212918436 TCATCTATGTGATAAGCATTAGG - Intergenic
947395561 2:229683604-229683626 TCATCATTGTCATCATCATCAGG - Intronic
947633648 2:231669078-231669100 TTGGCCATTTTATCAGCATCTGG - Intergenic
948899425 2:240948806-240948828 TCATCCTTGTTAACAGCACATGG + Intronic
1175490760 20:59379842-59379864 TCATCCATGTTCACATGATCAGG - Intergenic
1182516731 22:30863203-30863225 TTCTCTCTGTTATCAGCATCTGG + Intronic
956020224 3:64925999-64926021 TCATCCATGGGATCACCATTGGG + Intergenic
960048882 3:113222124-113222146 TCCTCCATGTTATCACCTCCTGG + Intronic
961765026 3:129203315-129203337 GCATCTATCTTATCAGCTTCTGG - Intergenic
966812265 3:183857305-183857327 ACATCCATGTAACCAGCACCTGG - Intronic
967247705 3:187504636-187504658 TGCTTCATGTTGTCAGCATCAGG - Intergenic
969443116 4:7228859-7228881 TCCTCCATGGCATCAGCAGCCGG + Intronic
970432540 4:16001927-16001949 TGATCCATTTTATCAGGATCAGG + Intronic
970505802 4:16729060-16729082 TCATCCATATTTTCAGGATCTGG - Intronic
974104646 4:57456032-57456054 TTATCCTTGTTATCAGCAGAAGG - Intergenic
976192878 4:82505134-82505156 TCATCCATGTTAACTGTTTCAGG - Intronic
978027799 4:103899206-103899228 ATATCCTTGTTATCAGCATATGG + Intergenic
981663472 4:147194904-147194926 TCATCTATGGTATCCACATCTGG - Intergenic
982243439 4:153323899-153323921 GGATCCATGTTATCTGCAACTGG + Intronic
983767409 4:171501933-171501955 TCATTCTTGTCATCAGCATATGG + Intergenic
986175956 5:5351994-5352016 TCACCCATGGGATCAGCATGTGG + Intergenic
991506848 5:67334104-67334126 TCATCCATGGGAGCTGCATCGGG + Intergenic
992076790 5:73199226-73199248 TCCTCCATGTTAGCTGCAGCAGG + Intergenic
992601296 5:78403529-78403551 TCATGCATGTAATCAGCTTTGGG + Intronic
996827207 5:127698381-127698403 TCATTGATATTATCAGCATGTGG - Intergenic
1001665795 5:173432843-173432865 TCTTCCATCTTCTCAGCCTCAGG + Intergenic
1003362555 6:5442596-5442618 TCATTCATATTTTCAGCATTGGG + Intronic
1005113460 6:22312002-22312024 TCATCATTGTTATCAGCAGAAGG + Intergenic
1005941692 6:30565225-30565247 TCATCCATGTTCAAAGCCTCAGG + Intergenic
1007831362 6:44641096-44641118 TCATCCATGTGATCAAGATTTGG - Intergenic
1010952507 6:82054187-82054209 TCATCAATGTTATAATCACCTGG + Intergenic
1020892456 7:13896084-13896106 TCTTCCATGTTATCATCAGGTGG - Exonic
1024231430 7:47366879-47366901 TCATCCGTGTTACCAGCACATGG + Intronic
1027710994 7:81601218-81601240 TCTACCCTGTTCTCAGCATCAGG - Intergenic
1033538843 7:142337372-142337394 TGATTCATGTTATAAACATCAGG - Intergenic
1036990945 8:13593158-13593180 TCACCCATTTTATTAGCAGCAGG + Intergenic
1037037830 8:14189965-14189987 TCATCCATGTTGTCAGAAATGGG + Intronic
1037791897 8:21951653-21951675 TAATGCAGCTTATCAGCATCTGG + Intronic
1046337262 8:112806608-112806630 TCATCTATTTGATCAGGATCTGG - Intronic
1046797801 8:118391707-118391729 TGATAAATGTTATCAGTATCAGG + Intronic
1048139497 8:131779670-131779692 TCATCCCTGTTGTTAGCATGTGG + Intergenic
1048361639 8:133702204-133702226 TCATCCCTTATATCAGCTTCTGG + Intergenic
1051792438 9:20821856-20821878 TCATCCATGTTATCAGCATCTGG - Intronic
1052580895 9:30352430-30352452 TCAGCCATGTTAAAGGCATCTGG + Intergenic
1054747153 9:68866035-68866057 TCATCCAAGGTAGCAGCAGCAGG + Intronic
1058294603 9:103290166-103290188 TTATGCATGTTATCAGCACAGGG + Intergenic
1059420712 9:114190207-114190229 TCATCCTTGGTCTCAGTATCTGG - Intronic
1059436975 9:114282847-114282869 TAAGCCTTGTTATTAGCATCGGG + Intronic
1061011691 9:127959597-127959619 TCACTCATGTTAACAGCATCGGG - Intronic
1203791441 EBV:153864-153886 TCTTCTTTGTAATCAGCATCAGG + Intergenic
1188757714 X:33984858-33984880 TCATTCTTCTTATCAGCATATGG - Intergenic
1191055896 X:56240344-56240366 TCATCCATGTTTTGTGCAACAGG - Intronic
1199245883 X:145603434-145603456 TCATCAATGTTATCGGCCTGAGG - Intergenic
1200291123 X:154875059-154875081 TCATCCATGTTATCACAAGTGGG - Intronic