ID: 1051794321

View in Genome Browser
Species Human (GRCh38)
Location 9:20847669-20847691
Sequence TTTTCCATGTAGAAGAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051794320_1051794321 -5 Left 1051794320 9:20847651-20847673 CCTTGGAATTATATTAGGTTTTC 0: 1
1: 0
2: 1
3: 19
4: 254
Right 1051794321 9:20847669-20847691 TTTTCCATGTAGAAGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051794321 Original CRISPR TTTTCCATGTAGAAGAGTTT TGG Intronic
No off target data available for this crispr