ID: 1051796446

View in Genome Browser
Species Human (GRCh38)
Location 9:20876855-20876877
Sequence AATTAAAAGGAGAAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 0, 2: 8, 3: 92, 4: 841}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051796446_1051796452 19 Left 1051796446 9:20876855-20876877 CCTGCCCCTTTCTCCTTTTAATT 0: 1
1: 0
2: 8
3: 92
4: 841
Right 1051796452 9:20876897-20876919 AGCAGCTGTAAAGTGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051796446 Original CRISPR AATTAAAAGGAGAAAGGGGC AGG (reversed) Intronic
901106572 1:6760912-6760934 CAAGAAAAGGAAAAAGGGGCCGG + Intergenic
901567847 1:10133612-10133634 AATAAAGAGGAGAAAGAGGCCGG + Intronic
901750624 1:11405142-11405164 AATTGAAAGAAGAAAGGAGGGGG - Intergenic
902066784 1:13694903-13694925 AATGAAAAGGAAAAAGGTGTGGG + Intergenic
902605673 1:17567948-17567970 ACTTTAAAAGAGGAAGGGGCTGG + Intronic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
902970232 1:20043107-20043129 AAGTAAAAGCAAAGAGGGGCTGG + Intronic
903027887 1:20442542-20442564 AATTTAAAGGAGCCAGGGGTGGG + Intergenic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
903595594 1:24491626-24491648 AATCAGAAGGAAGAAGGGGCAGG - Intergenic
903896930 1:26612884-26612906 AATTAACAGGAAAAAGGGGCAGG - Intergenic
904166058 1:28556146-28556168 TTTAAAAAGTAGAAAGGGGCCGG - Intronic
905357643 1:37395883-37395905 AAACAAAATGTGAAAGGGGCGGG + Intergenic
905454703 1:38080213-38080235 AATTAAAAGGGGGCAGGGGCTGG - Intergenic
905589375 1:39149235-39149257 AATTAAAAGGAGGCATTGGCTGG + Intronic
905817311 1:40961599-40961621 GATTAAAATCATAAAGGGGCTGG - Intergenic
906345172 1:45010416-45010438 GGTTAAGAGCAGAAAGGGGCGGG - Intronic
906471609 1:46135331-46135353 AATTAAAAAAAGAAAGGGAGAGG - Intronic
906580419 1:46930914-46930936 AATTAGAAGGCTACAGGGGCTGG - Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
907052293 1:51337721-51337743 AATTTTAAATAGAAAGGGGCTGG - Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907700457 1:56781827-56781849 ATTTTAAAGGAGAAAGGGGTTGG - Intronic
908598439 1:65712288-65712310 TTTAAAAAGGACAAAGGGGCTGG - Intergenic
908632535 1:66125456-66125478 AATTAAAACAAGTAAGGGGCAGG - Intronic
908822422 1:68102240-68102262 AAGTAAAAAGAGGAAGGGGCAGG - Intronic
909116753 1:71546978-71547000 AAGTAAAAGTAGAGAGAGGCTGG + Intronic
909258818 1:73460290-73460312 AAATAAAAAGAGAAAAGGGAGGG - Intergenic
909591262 1:77351807-77351829 AAGACAAAGGAGAAAGGAGCTGG + Intronic
909882722 1:80900455-80900477 AATTTAAAGAAGAAAGGGTGAGG - Intergenic
910847728 1:91619437-91619459 ATTTAAAATCAGAAATGGGCTGG - Intergenic
911620905 1:100065670-100065692 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
911835708 1:102616291-102616313 AATTTAAAGGAAAAATGTGCCGG + Intergenic
912421593 1:109545754-109545776 CATCAAAAGGGGAAATGGGCTGG + Exonic
913113012 1:115672747-115672769 AATTAAAAGGCAGAAGGGCCAGG + Intronic
914259709 1:145988606-145988628 AATTAACAAGAAAAAGGGGCCGG - Intergenic
914825742 1:151137147-151137169 AGTTAAGAGCAGTAAGGGGCTGG + Intronic
914877994 1:151526469-151526491 AAAAAAAAGAAGAAAGGGACTGG - Intronic
915150807 1:153829801-153829823 AAATAAAACGAAACAGGGGCCGG + Intronic
915478153 1:156166336-156166358 AATGAAAAGAAGATAGGGCCGGG - Intronic
915847602 1:159284154-159284176 AATCAAAAGGTTATAGGGGCCGG + Intergenic
916194954 1:162213861-162213883 AATTTATAGGAGAAATGAGCTGG - Intronic
916718378 1:167463449-167463471 TTTTAAAAGGAGAAAGGGAGAGG + Intronic
916718777 1:167467132-167467154 ACTGAAAAGGATAAAGGGGCCGG - Intronic
917362238 1:174189670-174189692 TTTTAAGAAGAGAAAGGGGCTGG + Intronic
917839242 1:178964109-178964131 AAATAAGAGGAGTAAGAGGCTGG - Intergenic
917948183 1:179998600-179998622 AATTAATAGAAGAAACAGGCTGG - Intronic
918093744 1:181318026-181318048 TTTTAAAAGGGGAAAGGGGTGGG - Intergenic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
919191076 1:194220158-194220180 AAATACAGGAAGAAAGGGGCCGG + Intergenic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
919597240 1:199579392-199579414 ATTTAAAAGCAGAAAAGTGCCGG + Intergenic
919897140 1:202015940-202015962 CATTCACAGGAGAAAGGAGCTGG - Exonic
920025620 1:202992694-202992716 AAGAAAAAGTAGAAAGGGGTAGG - Intergenic
920760550 1:208779979-208780001 AATTGAAAGGAGACAGTGGCTGG - Intergenic
920819522 1:209367355-209367377 AATTACAGGCAGAAAGGAGCTGG - Intergenic
921209307 1:212879214-212879236 AATTATAAGGAGGAAGGAGTTGG + Intronic
921472552 1:215567139-215567161 AATGTAAAAGGGAAAGGGGCTGG + Intergenic
921566943 1:216732835-216732857 AATTAAAAAAAAAAAGGGGGGGG + Intronic
922023635 1:221730077-221730099 AATTGAAAGGAGAAAGAGGAGGG - Intronic
922299229 1:224281656-224281678 TATTAAAAGGAAAAAAGGGGTGG + Intronic
922507712 1:226136061-226136083 ACTTTCAAGGAGGAAGGGGCAGG + Intergenic
922940388 1:229459424-229459446 ATTTAAAAGGGGAGATGGGCCGG - Intronic
923205549 1:231755335-231755357 AATATTAAAGAGAAAGGGGCTGG - Intronic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923446064 1:234072612-234072634 AATTGAACAGAGAAAGGGGTGGG + Intronic
923556032 1:235001033-235001055 AATTAAAAGAAAATAGAGGCCGG + Intergenic
923927843 1:238655442-238655464 AATTGAAATGAGAAAAGGTCAGG + Intergenic
924260438 1:242224611-242224633 CAGTAACAGGACAAAGGGGCTGG - Intronic
924550520 1:245072055-245072077 AAATAAAAGGAGAAGAGTGCTGG - Intronic
924676354 1:246182276-246182298 AGGTAATAGGAGAAAGGGGAAGG - Intronic
1063911647 10:10836211-10836233 AAAGAAAAGGAGAAAGGAGGAGG + Intergenic
1064180398 10:13109527-13109549 ATTCAAAAGGAAAAAGAGGCTGG + Intronic
1064216342 10:13403816-13403838 AATTAAAACCAGAAAGTGCCGGG + Intergenic
1064460921 10:15534617-15534639 AATTAAAGGGAGAAAGGAAAGGG - Intronic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1064535641 10:16354888-16354910 AATTTAAAGGGGAAAGGGCGGGG - Intergenic
1064644446 10:17446764-17446786 AATAAAAAGAAAAAAAGGGCTGG + Intronic
1064978643 10:21144427-21144449 AAATAAAATCAGAATGGGGCCGG + Intronic
1065293951 10:24257436-24257458 AAAGAAAATGAGAAAGGGGAAGG - Intronic
1065630520 10:27676280-27676302 AATTAAAATAAAAAAGGGGGGGG + Intronic
1065850427 10:29783131-29783153 AATAAAAAGGAGGAAGAGACAGG - Intergenic
1065918207 10:30369360-30369382 ATCTAAAAGGAGAGAGGGCCCGG - Intronic
1066364179 10:34760625-34760647 TATTAGAAGTAGAATGGGGCTGG - Intronic
1067357929 10:45548466-45548488 AATTAACTGGAAAAAGGGCCTGG + Intronic
1067811835 10:49434479-49434501 AATTCATAGGAGACAGGGCCAGG + Intergenic
1068031896 10:51714954-51714976 AATGAAAAAGAGCAAGGGACAGG + Intronic
1068419504 10:56771645-56771667 AATAAGAATGAGGAAGGGGCAGG + Intergenic
1069115011 10:64494208-64494230 AAATAAATGGATAAAGGGGGCGG - Intergenic
1069199607 10:65596358-65596380 AATTAAAAATAAAAAGAGGCTGG - Intergenic
1069972898 10:72188520-72188542 AAGGAAAAGGAGAAAGGGAAAGG + Intronic
1070052559 10:72903522-72903544 AATTAAAAGAAAAAGGGGGCTGG - Intronic
1070214290 10:74360759-74360781 AATAAAAACCAGAAAAGGGCAGG - Intronic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071239767 10:83692646-83692668 AGTTAACAGCAGACAGGGGCAGG - Intergenic
1071279859 10:84091215-84091237 AAAAAAAAGAATAAAGGGGCTGG + Intergenic
1071439068 10:85674274-85674296 AACCAAATGGAGAAAGAGGCAGG - Intronic
1071712313 10:88061573-88061595 TTATAAAACGAGAAAGGGGCCGG - Intergenic
1071800160 10:89050799-89050821 AATTAAAAAGAGAAATAGGCTGG - Intergenic
1071890552 10:90001738-90001760 ACTTAAAAGCAGAAAGGACCAGG - Intergenic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072257620 10:93635371-93635393 AATTAAAAGAAGGAATGGGGTGG + Intronic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1072845081 10:98820441-98820463 ATTACAAAGGAGATAGGGGCTGG + Intronic
1073200442 10:101730979-101731001 AAAAAAAAGGGCAAAGGGGCTGG - Intergenic
1073419041 10:103409000-103409022 AATGAGTACGAGAAAGGGGCTGG + Intronic
1073618681 10:105024511-105024533 AAATAAGAAGAGAATGGGGCAGG + Intronic
1074098754 10:110336497-110336519 GAAAAAAAGAAGAAAGGGGCAGG - Intergenic
1074449855 10:113550192-113550214 ATTTAGAAGGAAAAAGAGGCTGG - Intergenic
1075902601 10:126055160-126055182 CATTGAAAGGAGTAAGGGGATGG - Intronic
1076131213 10:128015245-128015267 TATCAAGAGGAGAATGGGGCCGG + Intronic
1076154156 10:128190047-128190069 AAATAAAAGTTGAAAGGGGCCGG - Intergenic
1076475458 10:130748666-130748688 TATAAACAGGAGAACGGGGCAGG + Intergenic
1077313560 11:1904803-1904825 GATTAAAAGAATAAAGAGGCTGG - Intergenic
1077829622 11:5852013-5852035 AATGAAAAGAAGAAAGTTGCAGG - Intronic
1077974056 11:7227339-7227361 AATTAAAAGGGCAATGGGGAAGG + Intergenic
1078469886 11:11578367-11578389 AGTTAAAAGGAGAAAGTGTGGGG - Intronic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1079353035 11:19709245-19709267 ATCTAAAAGGAGATAGGGCCAGG + Intronic
1079498626 11:21075813-21075835 AAATAAAAGGAGAAAATTGCTGG - Intronic
1079928924 11:26532989-26533011 AATTTAATGGGGAAAGAGGCAGG + Intronic
1079989681 11:27233523-27233545 GATAAAAAAGAGGAAGGGGCCGG - Intergenic
1080049262 11:27842243-27842265 TATTACTAGGAGAAAGGGGTAGG + Intergenic
1080076010 11:28150500-28150522 AATTAAAAGGAGAAAAGGTGAGG + Intronic
1080142972 11:28944501-28944523 AATAAAAAGGGGACATGGGCTGG + Intergenic
1080149654 11:29036028-29036050 GATTTAAAGGAGGAAGGGGCAGG + Intergenic
1080687508 11:34527457-34527479 AAAAAAAAGGGAAAAGGGGCTGG + Intergenic
1081073598 11:38641672-38641694 AACTAATGGAAGAAAGGGGCCGG - Intergenic
1081219282 11:40439746-40439768 CATTTAAAGAATAAAGGGGCCGG - Intronic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081286001 11:41270970-41270992 GATTTATAGGAGAAAGGGGAGGG - Intronic
1081332990 11:41826822-41826844 AATTCAAGGCAGAAAAGGGCAGG - Intergenic
1081479625 11:43473576-43473598 AATGAAAATGTGAAATGGGCCGG + Intronic
1081629540 11:44679777-44679799 AATTAAAAAGACATATGGGCTGG - Intergenic
1081861862 11:46337745-46337767 AAGGAAAAAGAGAAAAGGGCAGG + Intronic
1081920108 11:46767313-46767335 TATTGAAAGAAGAAAGGGCCGGG - Intronic
1081996585 11:47368947-47368969 AATTAAAAAGAGTAATAGGCTGG + Intronic
1082082049 11:48019644-48019666 AATTAGAAGGGGAAAGCTGCCGG - Intronic
1083319345 11:61835686-61835708 AATTAAAAAGAAGAGGGGGCCGG - Intronic
1083453806 11:62764496-62764518 AAAAAAAAAGAGAAAAGGGCTGG + Intronic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083608243 11:63991919-63991941 AATGAAAAGGGGATCGGGGCCGG + Intronic
1083816180 11:65133691-65133713 AATTCATAGGAGAAAGTGGGGGG + Intronic
1083850167 11:65360997-65361019 AAATAAAAAGAGATATGGGCTGG - Intergenic
1083989977 11:66240931-66240953 CATGAAAAGGAGAAAGCTGCAGG + Intronic
1084224297 11:67706021-67706043 ATTTAAAAAGAAAAAGAGGCCGG - Intergenic
1084391237 11:68878555-68878577 AATTAAAAAGAAAAAGGGCAGGG + Intergenic
1084712309 11:70851480-70851502 AGCAGAAAGGAGAAAGGGGCAGG - Intronic
1085080642 11:73631096-73631118 AATTAAAAAAAGAAAGAGACAGG - Intergenic
1085841523 11:80016854-80016876 AGTAAAAAGTAGAAAGAGGCAGG - Intergenic
1085874926 11:80394926-80394948 ATAAAAATGGAGAAAGGGGCCGG + Intergenic
1086975947 11:93132995-93133017 AATGAAGAGGATAAAGGGTCAGG - Intergenic
1087115031 11:94515582-94515604 AAAAAAAAGGAGAAAGGGAAAGG - Intergenic
1087220200 11:95538948-95538970 AATTAAAAGGTGAAAGTAACAGG + Intergenic
1087535001 11:99431823-99431845 TATTTAAAGCAGAAACGGGCTGG + Intronic
1087893140 11:103557741-103557763 AATGAAAATGGGACAGGGGCTGG + Intergenic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1088087764 11:106002088-106002110 AATGAGAAGGTGAAATGGGCCGG + Intronic
1088105654 11:106204072-106204094 AAATAAAAGGAGAATAAGGCAGG + Intergenic
1088152329 11:106759636-106759658 TATAAAAAGGAGAAATGGCCAGG + Intronic
1088591957 11:111411226-111411248 GAGTAGAAGGAGAAAGGAGCAGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089038499 11:115422370-115422392 GATTAAAAGGAAAAACAGGCAGG + Intronic
1089044797 11:115491267-115491289 AATTAAAAGAAAAAAAAGGCCGG + Intronic
1089072245 11:115709755-115709777 AATCAAGAGAAGAAGGGGGCAGG - Intergenic
1089550499 11:119272414-119272436 CATTAAGAGCAGAATGGGGCTGG - Intronic
1089624089 11:119740397-119740419 GATCAGAAAGAGAAAGGGGCTGG - Intergenic
1089717071 11:120370852-120370874 AATTAAAAGGTGATAAGGGAGGG - Intronic
1089798956 11:121007804-121007826 TAACAGAAGGAGAAAGGGGCTGG + Intergenic
1090029315 11:123194368-123194390 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
1090161615 11:124501244-124501266 AATTAAAATGACAAAGGAGTAGG + Intergenic
1090563977 11:127965823-127965845 ATTTAGAAGGAGAAAAGAGCAGG + Intergenic
1091720647 12:2810870-2810892 AAGAAAAAGAAAAAAGGGGCCGG + Intergenic
1092123324 12:6059246-6059268 AATAAAGCAGAGAAAGGGGCAGG - Intronic
1093209981 12:16296900-16296922 ATTTTAAATGAGAAAGGGGAAGG - Intergenic
1093228221 12:16511736-16511758 AAAGAAAAGAAGAGAGGGGCTGG - Intronic
1093236928 12:16620897-16620919 AATTAAAAGAAGAAAAAGGGAGG + Intergenic
1093405476 12:18799116-18799138 ATGTAAAACAAGAAAGGGGCAGG + Intergenic
1094260359 12:28490150-28490172 AATTAGGATGAGAAAGGGGCAGG - Intronic
1094331320 12:29297212-29297234 TAATAAAAGGATCAAGGGGCGGG + Intronic
1094648319 12:32349439-32349461 ATTTATAAGGAGAAATGGACAGG - Intronic
1095579978 12:43786577-43786599 ATTTAAAAAGTGAAAGGGGTGGG + Intronic
1095680339 12:44967366-44967388 AAATAAAAAAAGAAAGAGGCAGG + Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096794736 12:54069042-54069064 AATTAAAAGAATAAAGGTGATGG + Intergenic
1096815537 12:54199614-54199636 TAGTAAAAGAAGGAAGGGGCTGG + Intergenic
1096998437 12:55855432-55855454 AAAAAAAAGGAGACAGGGTCAGG - Intergenic
1097088385 12:56486542-56486564 TATGAAAAAGAGAAAAGGGCCGG + Intronic
1098589964 12:72199370-72199392 AAATAAAAGGAAAGAGGGACAGG + Intronic
1098608064 12:72419047-72419069 AATTATAAAGGGAAAGGGGTAGG + Intronic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1099770990 12:87055676-87055698 AATTATTAGGAGAAAGAAGCAGG - Intergenic
1099791848 12:87345650-87345672 AAATAATAGGAGAAAGTGGAGGG + Intergenic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1100628159 12:96358524-96358546 AATAAAAAGGATACAGGGGCCGG + Intronic
1100742543 12:97609388-97609410 AATTAAAAAAAGAAAGGATCAGG + Intergenic
1101647370 12:106643840-106643862 AACTACAAGGAGAAATGGACTGG - Intronic
1102290304 12:111693727-111693749 AAGTAAAACCAGGAAGGGGCTGG - Intronic
1102328090 12:112006235-112006257 AATTAAAAGGAGCAAGAGGCAGG + Intronic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102691498 12:114764924-114764946 ATTTAAAAGGAAAATGGGGCTGG + Intergenic
1102833533 12:116031281-116031303 TATAAAAATTAGAAAGGGGCCGG + Intronic
1102999433 12:117374193-117374215 ATGTAAAAGGGAAAAGGGGCTGG + Intronic
1103475567 12:121215833-121215855 AATTAAAAATCCAAAGGGGCTGG - Intronic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103757708 12:123222670-123222692 AAATAAAAGTAAAAAAGGGCTGG + Intronic
1103951182 12:124552021-124552043 AAGAAAAAGTAAAAAGGGGCTGG + Intronic
1104300082 12:127557058-127557080 GAATAAAAGGAAGAAGGGGCAGG + Intergenic
1105003399 12:132705801-132705823 TATTAAAAGGAAAGAGGGCCGGG - Intergenic
1105636560 13:22221053-22221075 AATTAAAAGGAGAACTGGTAGGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106074257 13:26443853-26443875 AATCAAAAGGCAACAGGGGCAGG - Intergenic
1106288838 13:28342177-28342199 AAATAAAACTGGAAAGGGGCCGG - Intronic
1106506892 13:30378356-30378378 GATGAAAAGGAGCAAGGGCCAGG + Intergenic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1107246695 13:38305323-38305345 AGTTTAAAGAAGAAAGAGGCTGG - Intergenic
1107468547 13:40669757-40669779 AATTAAAAGAACAAATAGGCCGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108261286 13:48659176-48659198 AATCTAAAGGAGAGAGGGCCAGG - Intronic
1108684950 13:52811116-52811138 AATCAAAAGGGGCAAGAGGCAGG - Intergenic
1108931422 13:55827357-55827379 AATTGAAGGGAGAAATAGGCAGG + Intergenic
1109290024 13:60462654-60462676 AATAAAAACTAGCAAGGGGCAGG - Intronic
1109509136 13:63346374-63346396 AATTTAAGGAAAAAAGGGGCTGG + Intergenic
1109885521 13:68537747-68537769 AATTAAAATGTTAAAGGAGCTGG - Intergenic
1111555568 13:89877067-89877089 TATTAAAAGGTGAAAGGGCCGGG + Intergenic
1111582165 13:90236560-90236582 AATTAAAAAGAAAAACAGGCTGG - Intergenic
1111682032 13:91455042-91455064 AATTAAATGGATAAAAGGGATGG - Intronic
1111726303 13:92013647-92013669 AATTTAAGGCAGACAGGGGCAGG - Intronic
1112110446 13:96291092-96291114 AAATAAAAGAAAAAATGGGCAGG - Intronic
1112534641 13:100240166-100240188 AATTTAAAGCAGAAATGGGCTGG - Intronic
1113291995 13:108917325-108917347 ATTTAACAGGAGGAAGGGGAAGG + Intronic
1114258095 14:21019289-21019311 AAACCAAAGGAGAAAGGGGCAGG + Intronic
1114421946 14:22590973-22590995 AATAAAAAGTGAAAAGGGGCCGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1116546403 14:46170747-46170769 AGTTAAAAAAAGAAAAGGGCAGG + Intergenic
1116619440 14:47180267-47180289 AAGTAAAAGGAGATAGGCACAGG + Intronic
1117180128 14:53182958-53182980 AATTATGTGGATAAAGGGGCAGG + Intergenic
1117285114 14:54279288-54279310 AAGTATGAGGGGAAAGGGGCTGG - Intergenic
1117366873 14:55037788-55037810 TATAAAAAGGAGGTAGGGGCCGG - Intronic
1117733307 14:58745599-58745621 TACTCAAAGGAGAAAAGGGCAGG - Intergenic
1117892016 14:60432694-60432716 AGGTAAAAGGAGAAAGGAACCGG - Intronic
1118079450 14:62341529-62341551 ATTTAAACTGAGAAAGGGGCAGG + Intergenic
1118650947 14:67893703-67893725 AATGAAAAGGAGAGTAGGGCGGG + Intronic
1119568755 14:75651223-75651245 AATAAAAGGGAAAAAGGGGAAGG + Exonic
1119886687 14:78149481-78149503 AATTAATAGGAGAAACTGGTTGG - Intergenic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120673984 14:87397476-87397498 AATTAGAAGGAGGAAGGGGGAGG - Intergenic
1120969681 14:90197021-90197043 AATTAGGAGGAGAAAGAGGGTGG - Intergenic
1121902713 14:97708578-97708600 AAACAAAAGGAGAGAGGGGAGGG + Intergenic
1121975625 14:98401385-98401407 AAAGAAAAAGAGAAAGGTGCAGG + Intergenic
1122705440 14:103618009-103618031 AATTAAAACCACAAAGAGGCCGG + Intronic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123472889 15:20568110-20568132 ATCTAAAAGGAGAGAGGGCCCGG + Intergenic
1123645116 15:22432243-22432265 ATCTAAAAGGAGAGAGGGCCCGG - Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1123666405 15:22612018-22612040 ATCTAAAAGGAGAGAGGGCCCGG - Intergenic
1123733194 15:23163101-23163123 ATCTAAAAGGAGAGAGGGCCCGG + Intergenic
1123751324 15:23360477-23360499 ATCTAAAAGGAGAGAGGGCCCGG + Exonic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124265219 15:28226976-28226998 TTTAAAAAGGAGAAACGGGCTGG + Intronic
1124283695 15:28384395-28384417 ATCTAAAAGGAGAGAGGGCCCGG + Exonic
1124299002 15:28527218-28527240 ATCTAAAAGGAGAGAGGGCCCGG - Exonic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124320224 15:28706432-28706454 ATCTAAAAGGAGAGAGGGCCCGG - Exonic
1124482289 15:30088985-30089007 ATCTAAAAGGAGAGAGGGCCCGG + Exonic
1124488747 15:30141087-30141109 ATCTAAAAGGAGAGAGGGCCCGG + Exonic
1124543829 15:30610051-30610073 ATCTAAAAGGAGAGAGGGCCCGG + Exonic
1124563783 15:30797484-30797506 AAATAAAAGGAGAGAGGGCCCGG + Intergenic
1124754781 15:32397236-32397258 ATCTAAAAGGAGAGAGGGCCCGG - Exonic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125702455 15:41699455-41699477 AATTAAGATGAGAAACGGGAAGG - Intronic
1126001770 15:44217494-44217516 AATTAAGAGGACACAGTGGCTGG + Intergenic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1126593146 15:50359600-50359622 ACTAAAAAGGAAAAAAGGGCCGG - Intergenic
1126643900 15:50855756-50855778 AATTGAAAGGATGAAGGGGCTGG - Intergenic
1126820401 15:52497458-52497480 ATTTAAAAGAAGAAATTGGCTGG + Intronic
1126851125 15:52797933-52797955 AATAAAAACGGGAAGGGGGCAGG + Intergenic
1126963247 15:54022468-54022490 AATTAAAACCACAAAGAGGCTGG - Intronic
1127068357 15:55263666-55263688 AATTAAGAAGAGACATGGGCTGG - Intronic
1127667516 15:61163243-61163265 AATTAAATGGACAAGGGGTCTGG + Intronic
1127778087 15:62284465-62284487 AAAAAAAAGGGAAAAGGGGCTGG - Intergenic
1127951482 15:63811511-63811533 ACATAAAAGATGAAAGGGGCCGG + Intronic
1128003684 15:64218245-64218267 AAATAAAAAGGGAATGGGGCTGG - Intronic
1128076354 15:64828474-64828496 AATTAAAAGGAAAACCCGGCTGG - Intergenic
1128229712 15:66025921-66025943 ACTTAAAAGGAGAAAAGGGCAGG + Intronic
1128538292 15:68507009-68507031 AATTTAAAGGGGAAAGGGCAGGG - Intergenic
1128581952 15:68817287-68817309 AAATAAAAGGGGGAAGGAGCAGG + Intronic
1128875676 15:71199252-71199274 AATTGAAAGGAGGAAGGGGACGG - Intronic
1128976806 15:72160307-72160329 GATGAAAGGGTGAAAGGGGCTGG + Exonic
1129037793 15:72661511-72661533 ACATAAAAGGAGAGAGGGCCCGG + Exonic
1129103122 15:73284881-73284903 TATTAAAAGTAGACAGGGCCGGG - Intronic
1129147337 15:73660569-73660591 AAGTAAAAGGAAAAATGAGCAGG - Intergenic
1129212096 15:74075716-74075738 ACATAAAAGGAGAGAGGGCCCGG - Exonic
1129398307 15:75265369-75265391 ACATAAAAGGAGAGAGGGCCCGG + Exonic
1129401915 15:75289644-75289666 ACATAAAAGGAGAGAGGGCCCGG + Exonic
1129729223 15:77920037-77920059 ACATAAAAGGAGAGAGGGCCCGG - Intergenic
1129839286 15:78733912-78733934 ACATAAAAGGAGAGAGGGCCCGG + Intergenic
1130052802 15:80497873-80497895 AATTTAAGGGAGAAGGGGGAAGG + Intronic
1130311088 15:82755029-82755051 AATTTAAAGGTGACAGGGACAGG - Intergenic
1130808663 15:87353703-87353725 AATTAAAAGGACACTGGGGCTGG - Intergenic
1131213324 15:90516606-90516628 GATAGAAAGCAGAAAGGGGCTGG + Intergenic
1132094570 15:98972570-98972592 AATTAAAAGGTGCAGTGGGCCGG + Intronic
1132135477 15:99333698-99333720 TCTTAAATGGAGAAAAGGGCTGG - Intronic
1133006764 16:2886502-2886524 AAAAAAAAGGACAAAGGGGCAGG - Intronic
1133682146 16:8129624-8129646 AGGTAAAAGGAGAAAAGGGGGGG + Intergenic
1133896953 16:9938824-9938846 GACTCAAAGGAGGAAGGGGCAGG - Intronic
1133971896 16:10574232-10574254 AGTTAAAAAGAACAAGGGGCCGG - Intronic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1134038684 16:11051450-11051472 ACTTGGAAGGAGGAAGGGGCCGG - Intronic
1134153471 16:11823326-11823348 AATAAAAAGAAGAAAATGGCTGG + Intergenic
1134309782 16:13065284-13065306 AAAGAAAAAGAGAAAGGGACAGG - Intronic
1134345079 16:13383150-13383172 AATTAAAAGTAGAAAGAAGGTGG + Intergenic
1134352093 16:13447184-13447206 AATGAAAATGTGAAAGGGACAGG - Intergenic
1134371658 16:13631677-13631699 AATTTAAAGGGGGAAAGGGCAGG - Intergenic
1134389185 16:13803371-13803393 CATTAAGATTAGAAAGGGGCGGG - Intergenic
1134602927 16:15547641-15547663 CATTAAAAGCTGAAAGTGGCTGG - Intronic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1134825432 16:17280824-17280846 AAATAAAAGGAGAGAGGAGATGG - Intronic
1135064783 16:19300250-19300272 AATAAAAAAAAGAAAGGGGTCGG + Intronic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1135525931 16:23213545-23213567 AATGAAAAGGAGAGGGGGCCAGG - Intronic
1136115593 16:28092308-28092330 AATAAAGAGGAGGGAGGGGCGGG + Intergenic
1136158514 16:28402254-28402276 AATAAAAAGGGAAAAGAGGCAGG - Intronic
1136204573 16:28713029-28713051 AATAAAAAGGGAAAAGAGGCAGG + Intronic
1136455960 16:30379627-30379649 AAAAAAAAAGAGGAAGGGGCAGG - Intronic
1136677204 16:31921424-31921446 TATTAAAAGGAAAAATAGGCCGG - Intergenic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136931186 16:34419270-34419292 AATTGAAACCAGAAAGGGCCAGG - Intergenic
1136973387 16:34992549-34992571 AATTGAAACCAGAAAGGGCCAGG + Intergenic
1137065358 16:35835592-35835614 AATTAGAAGTAGTTAGGGGCTGG - Intergenic
1137314823 16:47306796-47306818 AATAAAACGGAGAAAGAGGCCGG + Intronic
1137575869 16:49600022-49600044 AATTAAAAGGGGCAAGAGGCCGG + Intronic
1137763408 16:50959005-50959027 AAATAAAAGGAGGAAGACGCAGG - Intergenic
1138005973 16:53338134-53338156 AATTTTCAGAAGAAAGGGGCAGG + Intergenic
1138133960 16:54505302-54505324 AATAAAAAGGAGAAGGGAGTGGG + Intergenic
1138686310 16:58728981-58729003 ATTGAAAAGCAGAAAAGGGCCGG - Intronic
1139791393 16:69439503-69439525 AATTAAAAAAAGAAACAGGCCGG - Intronic
1140111444 16:72008724-72008746 AATGGAAGGGAGACAGGGGCGGG + Exonic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1141122800 16:81374524-81374546 CATTAACAGGAAAAAGGGACAGG - Intronic
1141363335 16:83418032-83418054 ATTAAAAAGGAGAAAGTGTCTGG - Intronic
1141906832 16:87032322-87032344 TATTAAAAGGAGAAAAGGAAAGG - Intergenic
1141942488 16:87286897-87286919 AAACACAAGGAGGAAGGGGCAGG + Intronic
1142162930 16:88568586-88568608 AACTAAAAGAACAAAGGAGCCGG - Intergenic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1142523065 17:518605-518627 AAAGAAATGGAGGAAGGGGCTGG + Exonic
1142783052 17:2196733-2196755 AAGTTAATGAAGAAAGGGGCCGG + Intronic
1143263709 17:5619827-5619849 ATTTTAATGAAGAAAGGGGCAGG - Intergenic
1143591410 17:7887654-7887676 GATTAGAAGAAGAGAGGGGCGGG + Intronic
1143875710 17:9989129-9989151 CATTAAAAGTGGAAATGGGCCGG - Intronic
1143994397 17:10994013-10994035 AATAAAAATGAATAAGGGGCCGG - Intergenic
1144223251 17:13119590-13119612 AAACAAAAGGAGAAAGGGCTGGG - Intergenic
1144281213 17:13728754-13728776 AATTAAAAAGAAAAATGGTCAGG - Intergenic
1144401082 17:14902603-14902625 TTTTAAAAGGAGAAAGGATCTGG - Intergenic
1144815186 17:18029152-18029174 AATTAATTGGAGAGAGGGGATGG - Intronic
1145927100 17:28656264-28656286 ATTTAAAAGAAGAAAAAGGCTGG - Intronic
1146888664 17:36489914-36489936 AATTAAGTGGACAAATGGGCCGG - Intronic
1147020570 17:37529164-37529186 AGGTAAATGGAGAAAAGGGCTGG - Intronic
1147229206 17:39004871-39004893 AATTATAAGAAGAAAGGCACAGG - Intergenic
1147303204 17:39546089-39546111 ATAAAAAAGGAGGAAGGGGCCGG - Intronic
1147883992 17:43672286-43672308 AATTAAAAGAAGAAAGACCCTGG - Intergenic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1148121980 17:45218555-45218577 AAAAAAAAGGAAAAAGGGGCCGG - Intergenic
1148712257 17:49690417-49690439 AATTAACAGGGGGAAGGGGGTGG - Intergenic
1149067121 17:52494156-52494178 AAGTCAAAGGAGAAAGGCACAGG - Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1149892101 17:60399356-60399378 ATTTAAAACTAGAATGGGGCTGG + Intronic
1150047538 17:61928052-61928074 AATAAAGTGGAGAAAGGGGCGGG - Intergenic
1150131744 17:62673008-62673030 AATAAAAAGGAGAAAGCCGTAGG + Intronic
1150619205 17:66796710-66796732 AAATAACAGCAGAAATGGGCTGG - Intronic
1150963913 17:69946198-69946220 AAAAAAAAGAAGAAAAGGGCAGG - Intergenic
1151181466 17:72332053-72332075 AATAAAAAAGAGAAAGGAACAGG + Intergenic
1151389978 17:73780012-73780034 AATTTAAACTAGACAGGGGCTGG + Intergenic
1151695367 17:75713361-75713383 TATTAAATGTAGAAAGGAGCTGG + Intergenic
1151785233 17:76272084-76272106 AAATAAAAGTCGAGAGGGGCCGG + Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152092232 17:78253325-78253347 AAATAGATGTAGAAAGGGGCAGG - Intergenic
1152984161 18:306951-306973 AATTTAAAGGGGAAAGGGCAGGG - Intergenic
1153017289 18:595689-595711 TATAAAAAGGGGAAAGGGGAAGG + Intergenic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1153033955 18:741228-741250 AAAAAAAAGGAGAAAAGGACAGG - Intronic
1154143113 18:11843200-11843222 AAAAAAAAGAAAAAAGGGGCTGG + Intronic
1154236301 18:12609499-12609521 AATGAAAAGGAGAAATGGCTGGG - Intronic
1154360910 18:13659523-13659545 AAAAAAAAAAAGAAAGGGGCTGG + Intergenic
1154406176 18:14093295-14093317 GTTTTAAAGGAGAAAGCGGCAGG - Intronic
1155318823 18:24598074-24598096 AATTAAAAGTGGAATGGGGCTGG + Intergenic
1155655913 18:28193204-28193226 ATTAAAAAGGTGAAATGGGCTGG - Intergenic
1156254799 18:35384797-35384819 AATAAAAAGCATAATGGGGCCGG + Intergenic
1157358032 18:46953188-46953210 AAAGAAAAGGAGGAAGGTGCCGG - Intronic
1157672129 18:49539612-49539634 AGATAAAGGGAGAGAGGGGCGGG - Intergenic
1158063380 18:53375367-53375389 AAGTAAAAGGAGAAAGGAAATGG + Intronic
1158093064 18:53737871-53737893 AATTTAAAGGGGAAAGGGTAGGG - Intergenic
1158185359 18:54765286-54765308 AATTAAGATCAGAGAGGGGCTGG - Intronic
1158329484 18:56345598-56345620 AAAATAAAGGAGCAAGGGGCTGG - Intergenic
1158371989 18:56817364-56817386 AATTAAAAGGAGAAAAGAAAGGG + Intronic
1158419188 18:57277908-57277930 AAGGAAAAGGGGAAAGGGGTTGG - Intergenic
1158466049 18:57690877-57690899 TATTAAAAAGAGAAAAAGGCCGG + Intronic
1158482475 18:57834322-57834344 TATTAAAAAGAGATGGGGGCTGG + Intergenic
1158653695 18:59309525-59309547 TATTAAGAGTAGAAAGAGGCCGG + Intronic
1158828229 18:61248452-61248474 AATTAAAGGGAGAATGGGGTGGG + Intergenic
1158920031 18:62181706-62181728 AATAAAAAGGAGAAGGCGACTGG - Intronic
1159044762 18:63358880-63358902 AATTAAAAAGAAAAAGAGGCAGG + Intronic
1159160093 18:64632504-64632526 TATAAAAAAGAGAAAGCGGCTGG - Intergenic
1159857715 18:73608736-73608758 AATTTGAAGGAGAAAAGAGCTGG - Intergenic
1160304355 18:77717951-77717973 ATTAAAAAGATGAAAGGGGCCGG + Intergenic
1161074793 19:2280368-2280390 CATTAAAAAGAGAGAGAGGCTGG - Intronic
1161274131 19:3405897-3405919 AAAGAAAAAGAAAAAGGGGCCGG - Intronic
1161671158 19:5611074-5611096 AATGAAAAGGAGATAGCGTCTGG + Intronic
1161675949 19:5649523-5649545 AATGAAAAGGAGATAGCGTCTGG - Intronic
1161862020 19:6805026-6805048 AATTAAAAGGAGGTATGGGCCGG - Intronic
1162197821 19:8999221-8999243 AATTAAAAGGCATCAGGGGCTGG + Intergenic
1162546019 19:11330195-11330217 GAATAAAAGGGGAAAGGGACTGG + Intronic
1163240046 19:16056486-16056508 AATAAAAAGAAGAAAAGGCCGGG + Intergenic
1163427388 19:17246714-17246736 ATTAAAAGGGAAAAAGGGGCAGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163970203 19:20786062-20786084 AATTAAAAGAAAAATTGGGCTGG - Intronic
1165009253 19:32831977-32831999 AATTAAAAAGAAAATGGGGCTGG + Intronic
1165116405 19:33531559-33531581 AAGGAAAAGAAGGAAGGGGCCGG + Intergenic
1165177130 19:33938715-33938737 AATTAAATGGAGGTAGGGACGGG - Intergenic
1165211286 19:34237895-34237917 TATTAAAAGGAGGTAGGGGCTGG + Intergenic
1165510596 19:36264579-36264601 GATTGAAAGGAGAAAGAGGTTGG + Intergenic
1166287075 19:41837785-41837807 AATTCCAAGGAGGAAGGGGAAGG - Intronic
1166607281 19:44155505-44155527 AATTATAAGGAGGAAGAGGAGGG + Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166847199 19:45735971-45735993 AAATAAAAAAAGAAATGGGCTGG - Intronic
1166924516 19:46257701-46257723 AATTAAAAAGATAAAAGGCCAGG - Intergenic
1167032614 19:46973383-46973405 AATTAAAATGAAAAATTGGCCGG + Intronic
1167039520 19:47014624-47014646 AAAAAAAAGAAGAAAAGGGCTGG - Intergenic
1167212401 19:48141426-48141448 AGTTAAAAGGTGCAAAGGGCTGG - Intronic
1167391095 19:49195664-49195686 AAATTAAAGTAGAAACGGGCTGG - Intronic
1167397905 19:49243640-49243662 AATAAAAAGGTGTGAGGGGCAGG + Intergenic
1167480742 19:49729360-49729382 AAGTAAAGGAAAAAAGGGGCTGG - Intergenic
1167670636 19:50851309-50851331 ATTTCAAAGGAGGAAGAGGCTGG + Intergenic
1167978985 19:53256561-53256583 CATTGAAAAGAGAAAGAGGCTGG - Intergenic
1168053302 19:53846177-53846199 GATTAAAAAAAGAAAGAGGCCGG + Intergenic
1168298506 19:55389697-55389719 AATTCACAGCAGACAGGGGCTGG - Intronic
1168342089 19:55630585-55630607 AAGGAAAAAGAAAAAGGGGCCGG - Intergenic
1168555647 19:57337363-57337385 TATTAAAAGAATAATGGGGCCGG - Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925871573 2:8276328-8276350 AATTTATAAAAGAAAGGGGCTGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926701871 2:15809421-15809443 AATTAAATGGGGAAGGGAGCTGG + Intergenic
926711284 2:15883475-15883497 AATTAAAAGAAGAAAAGGAAGGG + Intergenic
927864164 2:26578122-26578144 AGATAAAAGCAGAGAGGGGCAGG - Intronic
928554218 2:32406232-32406254 AATTAAAAGAAAAAAGTAGCTGG + Intronic
928698816 2:33878098-33878120 AAATGAAAGAAGAAAGGGCCAGG - Intergenic
928739805 2:34338149-34338171 GATTTATAGGAGAAAGGGTCTGG - Intergenic
928936268 2:36681770-36681792 AAATAGAAGGAGAAAGGCACAGG + Intergenic
929429826 2:41877835-41877857 CATTAAAATGAGAAAGGATCAGG + Intergenic
929641631 2:43585966-43585988 ATATTAATGGAGAAAGGGGCTGG + Intronic
929670364 2:43872389-43872411 AATTTAAAGGAGAAAGTGAGAGG + Intronic
930189386 2:48441672-48441694 CATAAACACGAGAAAGGGGCAGG - Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930642007 2:53862896-53862918 AGGGAAAAGGAGAAAGGGGGTGG - Intergenic
930876883 2:56228826-56228848 AATAAACGGGAGAAAGGGCCTGG - Intronic
930990333 2:57646891-57646913 AATTAATAGGGGAAAGGGAAGGG - Intergenic
931202387 2:60110913-60110935 TATTAAAAAGAGAAAGGAGAGGG + Intergenic
931220710 2:60285871-60285893 ACTTTAGAGGAGCAAGGGGCGGG + Intergenic
931301677 2:60985795-60985817 AATAAAAAAGAGAAAAGGCCGGG - Intronic
931361855 2:61584659-61584681 AATTAAAAGTAAAAATAGGCCGG + Intergenic
932184522 2:69681626-69681648 AAATAAAATCAGAAATGGGCCGG - Intronic
932643742 2:73480002-73480024 ACTTAACAGGAGAAAGAGACTGG - Intronic
933158437 2:78999058-78999080 CATTAAAATCAGAAAAGGGCTGG + Intergenic
933650067 2:84843382-84843404 ATGTGAAAGGAGAAAGGGGTTGG - Intronic
934525464 2:95049112-95049134 ATTTAAAAGCAAAAAAGGGCTGG - Intronic
934981370 2:98845488-98845510 AATTGAAAGGAAAATGGGCCAGG - Intronic
935042281 2:99444114-99444136 TATTAAAGGAAGAAAAGGGCTGG - Intronic
935872279 2:107463903-107463925 AATGAAAAGGTAAAAGGGGATGG - Intergenic
935914480 2:107934814-107934836 TGTTAAAAGGTGAAAGGGACAGG + Intergenic
936252772 2:110879846-110879868 GATTGAAAGGAAAAAAGGGCTGG + Intronic
937071310 2:119065857-119065879 TATTAATAGGTGAAAGGGGTGGG - Intergenic
937341154 2:121091444-121091466 AAGGAAAAGAAGAGAGGGGCTGG + Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
938388588 2:130885863-130885885 AAATAAAAGAAGAAAAGGCCGGG - Intronic
938669136 2:133570536-133570558 AAATATAAGGGGAAAGGGGTGGG - Intergenic
939054822 2:137352126-137352148 AATAAAAAAGAGAAGGGGGCAGG + Intronic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940199485 2:151134665-151134687 TATTAAAAGGAAAAATAGGCTGG + Intergenic
940972555 2:159909489-159909511 GATTCAAAGCAGAAAAGGGCAGG - Intergenic
940976279 2:159948655-159948677 AAAAAAAAGGAGAAAAGGGAAGG + Intronic
942150797 2:173074961-173074983 ATTAAAAAGAAGAAATGGGCTGG - Intergenic
942158623 2:173158330-173158352 TTTTAAAGGGAGAAAGGGGGAGG + Intronic
942562457 2:177235128-177235150 AAATAAAAGCAGACAGGGACAGG + Intronic
942724236 2:178989295-178989317 ACTTAACAATAGAAAGGGGCTGG + Intronic
942867543 2:180693278-180693300 AATAAAAAGAAGAAAGGAGGCGG + Intergenic
943902673 2:193461000-193461022 ATTTAAAAGGAGAATAGGGTGGG + Intergenic
944112126 2:196144192-196144214 AATTAAAAAAAAAAAGAGGCCGG + Intronic
944372795 2:199005909-199005931 AAAAAAATGGAGAAAGGAGCTGG - Intergenic
944645056 2:201771351-201771373 AAACAAAATGAGATAGGGGCCGG - Intronic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
945209028 2:207363314-207363336 AATGAAGAGGAGAAAGGGAAAGG + Intergenic
945879383 2:215310938-215310960 ATTAAAAAGGAGGATGGGGCCGG + Intergenic
945915622 2:215701275-215701297 AATAAAAATGAGAACTGGGCTGG + Intergenic
945960985 2:216134730-216134752 GTTTAAAAGAAGGAAGGGGCTGG - Intronic
946297187 2:218794485-218794507 TATCAAAAGGAGAAAAGGGCGGG + Intronic
946416419 2:219542214-219542236 TATCAAAAGGACAACGGGGCGGG + Intronic
946940094 2:224761232-224761254 GAGTAAAGGGAGAAAGGGACAGG + Intergenic
947419471 2:229929228-229929250 TATTAAAAAGAAAAAGAGGCCGG - Intronic
947622581 2:231600277-231600299 GATTAACAGGAGAAAAGGGCTGG - Intergenic
947943343 2:234077667-234077689 AATTAAAATCAGAAATAGGCCGG - Intergenic
948685422 2:239666772-239666794 AATGGAAAGAAGAAAGGAGCAGG - Intergenic
1168975451 20:1962377-1962399 GATGAAGAGGTGAAAGGGGCAGG + Intergenic
1169053004 20:2596333-2596355 AATTAAAAGTAGTACCGGGCCGG + Intronic
1169222838 20:3836358-3836380 AATTAAAAGGATTAAAGGGGTGG - Intergenic
1169729854 20:8774793-8774815 AACTAAAAGGAGACAAGGGTGGG + Intronic
1169949618 20:11029021-11029043 AAGAAAAAGGAGAAAGGGCTGGG - Intronic
1170403870 20:16015991-16016013 AATTAGTAGGAAAAATGGGCAGG - Intronic
1170428274 20:16256847-16256869 AATAGAAAGGAGAGAGGGTCTGG + Intergenic
1170861524 20:20108610-20108632 AACTAAAATGACAAAAGGGCTGG + Intronic
1171040892 20:21762554-21762576 TATTTTAAGGAAAAAGGGGCTGG - Intergenic
1171085834 20:22237451-22237473 TATTAAAAAGAGGAAGGGGAAGG - Intergenic
1171959753 20:31485316-31485338 AATTTAAAGGAGGTTGGGGCAGG + Intergenic
1171966522 20:31534787-31534809 AAAAAAAAGAAGAAATGGGCCGG + Intronic
1172453412 20:35045962-35045984 TATTAAAAGAAGAAAGGGTCAGG - Intronic
1172712196 20:36934090-36934112 AATTAAAAGCTAACAGGGGCTGG - Intronic
1172832863 20:37851054-37851076 ATTTAAAATGAGTAAGTGGCTGG + Intronic
1173064785 20:39700032-39700054 AATTAAAAGTACAAAGGGAGTGG + Intergenic
1173265079 20:41471936-41471958 AATGAAAAAGACAAAGGGCCGGG + Intronic
1173390208 20:42624990-42625012 AGTGAAAAGGAGACAGGGTCAGG + Intronic
1173484017 20:43427179-43427201 AATTAAACTGAGAAAAGGACAGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173935227 20:46855992-46856014 AATTAAAAGTAAAAATAGGCTGG + Intergenic
1174799266 20:53549547-53549569 AAGTAAAAGAAAAAAGGAGCAGG + Intergenic
1174860871 20:54089745-54089767 AATCAAAAGTAGAAAAGAGCAGG + Intergenic
1175091605 20:56509319-56509341 AACTAAAAGGAAAAATGGGCTGG + Intronic
1175112728 20:56660082-56660104 AGATAAAAGGAGAAAGGGAGGGG + Intergenic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1178513259 21:33225256-33225278 AATTAAAACCAGAGAAGGGCTGG - Intergenic
1178670481 21:34586655-34586677 AAGTAGAAGGAGAAAAGGACAGG + Intronic
1178874836 21:36405737-36405759 AAATTTAATGAGAAAGGGGCAGG + Intronic
1179062328 21:37990416-37990438 AATTTAAAAGAGAAAGAGGAAGG + Intronic
1179326654 21:40353021-40353043 AATTTAATGGAGAAATGGTCTGG + Intronic
1179641407 21:42749839-42749861 GTTTAAAAGTACAAAGGGGCTGG + Intronic
1180663796 22:17493266-17493288 TATTTAAAGGAAAAAGAGGCCGG - Intronic
1181596635 22:23919346-23919368 AAAAAAAGAGAGAAAGGGGCCGG + Intergenic
1182172152 22:28242211-28242233 CATTAGAAGGAGTAAAGGGCCGG - Intronic
1182264754 22:29105552-29105574 AATTTTAAGAAGAAAGGGGCAGG + Intronic
1182306991 22:29376898-29376920 TTTTAAAAAGGGAAAGGGGCCGG + Intronic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1182480064 22:30602516-30602538 AAATAAAAGAAAAAAGAGGCCGG - Intronic
1182525493 22:30915152-30915174 ATTTAAAAGGAAAAAAAGGCTGG + Intergenic
1182599938 22:31454100-31454122 AAAAAAAAGGAGAAAAGGGTGGG + Intronic
1183128340 22:35807097-35807119 AATTTAAAAAAGAAAGGGCCAGG - Intronic
1183644990 22:39120178-39120200 AAAAAAAAGAAGAAAGGGCCGGG - Intronic
1183767215 22:39889375-39889397 AATGAAAAAGAGAAAGGGAATGG - Intronic
1183790126 22:40060674-40060696 AATTAAAAGGGAAAAGGTGCTGG + Intronic
1183936232 22:41264028-41264050 AACCAAAGGGAGAAAAGGGCTGG - Intronic
1184124100 22:42474725-42474747 ATTTAAAAGGTGACTGGGGCTGG + Intergenic
1185051833 22:48558037-48558059 AATCTAAAGGAGACAGGGGAGGG - Intronic
949273290 3:2246705-2246727 CATGAAAAGGAGAGAGGGGATGG + Intronic
949300326 3:2576129-2576151 TATAAAAAGAAGAAAGCGGCTGG - Intronic
950075304 3:10182703-10182725 AATTAAAAAAATAAAGGGCCTGG - Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950260936 3:11543133-11543155 GATTAAAAGGAGAAAACGACAGG - Intronic
950373487 3:12551063-12551085 AGTCCAAAGGAGACAGGGGCAGG - Intronic
950642379 3:14356713-14356735 TAGTAAAAGGAGAAACTGGCCGG + Intergenic
951505211 3:23437179-23437201 AACTACAAGGAGAAAGGCCCTGG - Intronic
951847304 3:27098071-27098093 AAATGAAAGCAGAAAGAGGCAGG + Intergenic
952126155 3:30303059-30303081 TATTAAAAGGATACAGGGCCAGG - Intergenic
952271389 3:31835433-31835455 AATTAAAAGGAGGCAAGGGAGGG + Intronic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
953338758 3:42116525-42116547 AATTATAAGGATTAAAGGGCAGG - Intronic
953633831 3:44644721-44644743 AATAAAAAGTAGACATGGGCTGG + Exonic
953762511 3:45700966-45700988 CATTAAAAAGAGATAGAGGCTGG - Intronic
954944875 3:54413528-54413550 AAATATAAAGAGAAAGGGGCAGG - Intronic
955326296 3:58011206-58011228 AAATAAAAGGAGGACCGGGCTGG - Intronic
955661144 3:61300421-61300443 AATTAACAGAAGAAAAGGGTAGG + Intergenic
956009639 3:64817054-64817076 AATGAACAAGAGAAAGGAGCTGG - Intergenic
956022234 3:64945266-64945288 AATGAAAAGGGGAAAAGGACAGG - Intergenic
956572269 3:70710061-70710083 GATTAAAAGCAGAAAGGGATAGG - Intergenic
956673530 3:71713912-71713934 ATTTTAAAGGAGATATGGGCTGG + Intronic
956801433 3:72762960-72762982 AATTAAAAGTAGAAACAGGCCGG - Intronic
956997013 3:74838150-74838172 AATGAAAAGGAGAAATGTGGTGG + Intergenic
959120676 3:102228564-102228586 AATTTAGAGGAGAAAAGGGCCGG + Intronic
959447664 3:106459959-106459981 AAATAAAAAGAGAAACAGGCCGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959849015 3:111066712-111066734 AACTAGAAGGACAAAGGGGAAGG + Intergenic
960758014 3:121039740-121039762 AATAAAAAAGAGAAAGAGGAGGG - Intronic
960803648 3:121562558-121562580 AATTAAATAGAGACAGGGTCTGG + Intergenic
960965496 3:123101515-123101537 AGACAAAAGGAGAAAGGGCCAGG - Intronic
961432716 3:126894429-126894451 AAACATAGGGAGAAAGGGGCAGG + Intronic
962326524 3:134438520-134438542 AGTTAAAAAAAAAAAGGGGCGGG - Intergenic
962748150 3:138412894-138412916 AGTTAAAATTAAAAAGGGGCGGG - Intergenic
962973570 3:140426876-140426898 ACTTAAAGAGAGAATGGGGCTGG + Intronic
963263562 3:143216752-143216774 AATAAAAAGAGGAAAGGGGGAGG - Intergenic
963559908 3:146851313-146851335 AAGGAAAAGGAGAAAGGAGGAGG + Intergenic
963938350 3:151076908-151076930 AATGAAAAGGAGATAAGGGATGG - Intergenic
964008862 3:151865511-151865533 AAATAAAAGGATAAATAGGCAGG - Intergenic
964754662 3:160082606-160082628 AATTAATAGGAGAAACGTGCAGG - Intergenic
965073498 3:163946662-163946684 TATTAAAAGGAAAAATAGGCTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965853403 3:173058917-173058939 AAAAAAAAGGTGAAAGGAGCTGG - Intronic
966685271 3:182686609-182686631 AATAAAAGGGGGAAATGGGCTGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966923601 3:184630212-184630234 AAATAAATGCAGGAAGGGGCTGG + Intronic
967516335 3:190373151-190373173 AAGTATAAGGAGAAAGGGAAGGG - Intronic
967589844 3:191260143-191260165 AATTAAAAGGATACACAGGCTGG - Intronic
967702788 3:192613271-192613293 AAATAAAATGAGAAAGGGTTTGG - Intronic
967821678 3:193844528-193844550 AAGGAAAAAGAGAAAGGGGCTGG + Intergenic
967853688 3:194100757-194100779 AATAAAAAGGAGAGAGAGGGAGG + Intergenic
967893655 3:194380983-194381005 AATTAAAAGTAGGAAGCGGCCGG + Intergenic
968166180 3:196467015-196467037 CATTAAGAGAAAAAAGGGGCTGG - Intergenic
968239603 3:197064966-197064988 TATTAAAAGGAGATAAGGGCCGG - Intronic
969394964 4:6914741-6914763 ATTAAAAAAGAGAAAGAGGCTGG + Intronic
970322188 4:14885862-14885884 GATCAAAGGGAGAAAGAGGCAGG + Intergenic
970608038 4:17700124-17700146 AATTAAACGGGAAAAGGGGGTGG + Intronic
970867220 4:20772928-20772950 AATAAGAAAGGGAAAGGGGCCGG - Intronic
971108408 4:23553665-23553687 AATAAAACAGAGAAAAGGGCAGG + Intergenic
971138127 4:23892618-23892640 AATTAAATAGAGAAATGGCCCGG - Intronic
971918033 4:32899553-32899575 AAATAAATAGAGAAAGAGGCAGG - Intergenic
971926886 4:33022734-33022756 AATTAAAAAAATAAAGGGGCCGG + Intergenic
972325071 4:38007547-38007569 TATTAAAAGCAGATAGGGACAGG - Intronic
972417486 4:38856165-38856187 TATTAAATGGAGGAAGTGGCCGG - Intronic
972520977 4:39856517-39856539 ATTTAAAAGGAAAATGCGGCTGG + Intronic
973192282 4:47399083-47399105 AATAAATATGAGAAAGGGCCAGG - Intronic
973799045 4:54458740-54458762 AATTAAAAAAAGAAATAGGCTGG - Intergenic
974007946 4:56578207-56578229 AAATAAAAGTACAAAGGAGCGGG + Intronic
974095908 4:57363709-57363731 ATTTTAAAGGAGATAGGGGTGGG - Intergenic
974226364 4:59050389-59050411 TATCAAAAAGAGAAAGTGGCCGG - Intergenic
974772631 4:66435497-66435519 AATTCAAAGCAAAAAAGGGCTGG - Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975401995 4:73949409-73949431 ATTTTAAAGGAGAAAGGGAGAGG + Intergenic
975485112 4:74927155-74927177 AAATACAAGGAGAAAATGGCTGG - Intergenic
975822204 4:78283036-78283058 AATGAAAAGAAGCAAGGGGGTGG - Intronic
976087725 4:81423241-81423263 ATTAAAGAGGAGGAAGGGGCCGG - Intergenic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
976390481 4:84499664-84499686 AAATAAAATGAGAAAGGGGAGGG + Intergenic
976648033 4:87405820-87405842 AATTAAAAGGACAAACGGATCGG - Intergenic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977096621 4:92753680-92753702 AACTAAAATGAGTAATGGGCTGG + Intronic
977157096 4:93588209-93588231 TATAAAAAGAAGAAAGGGGGAGG + Intronic
978237937 4:106482617-106482639 AAAAAAAAGGAGAGAGGAGCGGG - Intergenic
978861449 4:113454514-113454536 AGCTGAAAGGAGAAAGGGGGAGG + Exonic
978902596 4:113970656-113970678 AAATTAGAGGAGAGAGGGGCTGG + Intronic
978976214 4:114877650-114877672 ACTTAGAAGGAGAAATAGGCCGG + Intronic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979376026 4:119947895-119947917 AATGAAAAGGAGATAGAGACAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979512088 4:121566475-121566497 AAGTAAAAAGAGAAAGGTGGAGG + Intergenic
980582946 4:134776013-134776035 ACTTAGAAGAAGAAAGGAGCTGG - Intergenic
980719027 4:136668808-136668830 AAGGAAAAGGAGAAAGCAGCTGG - Intergenic
981030814 4:140123834-140123856 AATAAAAAGGATAAAGGTGCAGG + Intronic
982059061 4:151584726-151584748 AATTACAGGTAGAAAGAGGCTGG - Intronic
982070750 4:151692482-151692504 AATCAGAAGGAGAAAATGGCAGG + Intronic
982450128 4:155543173-155543195 AAATAAAAAGAGAGAGTGGCTGG + Intergenic
982655492 4:158143562-158143584 AATGAAAAGGAAAAAGTGACAGG + Intronic
982928386 4:161368958-161368980 AAATAAAAGAATAAAGGGGGAGG - Intergenic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
983897855 4:173100693-173100715 AAAAAAAAGGAAAAAGGGGGTGG + Intergenic
984549021 4:181138824-181138846 GATTAAAAGAAGAAGGGGGGTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984949400 4:184995572-184995594 TATTAAAAGGAAAAAAAGGCCGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985879835 5:2629944-2629966 TGTAAAAAGGAGAAAGGGCCAGG + Intergenic
986698410 5:10379202-10379224 AAATAAAAGGATAAAGAGGCAGG - Intronic
986762096 5:10889571-10889593 AAACAAGAAGAGAAAGGGGCTGG + Intergenic
987320286 5:16762662-16762684 AATTAAAAGTTGAATGTGGCTGG + Intronic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
988092940 5:26566806-26566828 AATAAAAAGGAAAAAGTGGAAGG + Intergenic
988122081 5:26977680-26977702 AATTGAAAGGAGAAAGATCCAGG + Intronic
988471535 5:31544113-31544135 AATTAAAAGGAAAAAGTAACAGG + Intronic
990126582 5:52526246-52526268 AAATAAAAGAATAAAGGAGCTGG - Intergenic
990281417 5:54254762-54254784 AATCAACAGGGGAGAGGGGCAGG + Intronic
990338975 5:54803641-54803663 AATTAAGAGGAAAAAGAGGAGGG + Intergenic
990550115 5:56867126-56867148 ACTCAAAAGGAAAAAGGAGCTGG - Intronic
990608221 5:57431203-57431225 TATTAAAAGAAGAAAGGGAGAGG + Intergenic
991662130 5:68961264-68961286 AATCAAAATAAGACAGGGGCCGG + Intergenic
992164985 5:74040609-74040631 AATTAACCTGAGAAAGGGGGAGG - Intergenic
992288820 5:75263566-75263588 TATTAAAAGGTGAAATCGGCTGG + Intergenic
992600404 5:78393060-78393082 AATAAAAAGAAGAACAGGGCAGG - Intronic
992835517 5:80637329-80637351 AATTAAAAAGATAAATAGGCTGG + Intronic
993041775 5:82822846-82822868 ATTTAAAAGGGGAGAGAGGCTGG + Intergenic
993407458 5:87529297-87529319 AATCAAAAGGAAAAAAAGGCTGG + Intergenic
993688068 5:90965553-90965575 CATTAAAAGATTAAAGGGGCGGG - Intronic
993772908 5:91953249-91953271 AAGAAAAAGGAAGAAGGGGCAGG + Intergenic
995431288 5:112081000-112081022 AATTGAAAGTAGAAATAGGCTGG + Intergenic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995510871 5:112908027-112908049 GATTAAAAAAAGAAGGGGGCGGG + Intronic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
995874963 5:116780827-116780849 AATTAACAGGAGAAACTGCCTGG + Intergenic
996340496 5:122433582-122433604 TATGAAATGGAGAAAGGAGCAGG + Intronic
996546797 5:124687897-124687919 AAATAAAAGTAGCAGGGGGCAGG + Intronic
997149212 5:131474166-131474188 AATTAAAATGAGAATAGGGCGGG + Intronic
997528264 5:134567180-134567202 AAGGAAGAGGTGAAAGGGGCTGG + Intronic
997747128 5:136309104-136309126 AATGCCAAGGAGAAAAGGGCAGG - Intronic
998354299 5:141521828-141521850 GATTAAGAGGAGAGAGAGGCTGG - Intronic
998906708 5:146912801-146912823 AATCAAAAGTTGAAAGAGGCCGG - Intronic
999072797 5:148765356-148765378 AAGTAAAATGAGAAAGGAGAGGG - Intergenic
999112464 5:149133993-149134015 AATGAAAATGAAAAAGGAGCAGG - Intergenic
999663019 5:153885216-153885238 TTTTAAGAGGAAAAAGGGGCTGG - Intergenic
1000142621 5:158420875-158420897 ATTAAAAAAGAAAAAGGGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1001103621 5:168834394-168834416 ATTTAGATGGAGAAAGGGCCGGG + Intronic
1001213947 5:169837915-169837937 ATTTAAAAGAAGCAAGGGGCAGG + Intronic
1001264869 5:170266916-170266938 AATTAAAAGAAGAAAGCAGTCGG + Intronic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001956957 5:175854201-175854223 AGATAAAAGGAGAAAAGAGCTGG - Intronic
1002338603 5:178498791-178498813 TATTAAAAGCAAAAAGTGGCTGG + Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003496038 6:6663987-6664009 GACTAAGAAGAGAAAGGGGCAGG - Intergenic
1003603930 6:7542476-7542498 AAGTAAAAGAGGAAAGGAGCGGG + Intronic
1003676997 6:8214371-8214393 AGTTAAAAGTATACAGGGGCTGG + Intergenic
1003790990 6:9547473-9547495 AAGTAAAAGGAGTAAGGCTCAGG - Intergenic
1003800547 6:9660567-9660589 AATTAAAAGGAAAAAGTATCAGG - Intronic
1003936397 6:10979041-10979063 AATAAAAAGGATGAATGGGCCGG + Intronic
1003985515 6:11431083-11431105 ACCTAAAAGGGGAAATGGGCAGG - Intergenic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004001717 6:11602459-11602481 AAGTTAAAGGAGAAAGGGACAGG - Intergenic
1004340809 6:14805892-14805914 AACTAGAAGAAGAAGGGGGCAGG + Intergenic
1004771867 6:18792796-18792818 AAAGAAAAGGAGAAAGGATCAGG - Intergenic
1004934010 6:20489968-20489990 AATTAAAAGGGGGACGGGGGTGG + Intronic
1005120341 6:22382484-22382506 AATTAAAGGGAGCAAGCAGCCGG + Intergenic
1005140835 6:22629734-22629756 AGTTAAAAGGAGAACAGAGCAGG - Intergenic
1005211267 6:23466956-23466978 ACATAAAAGGACAAAGAGGCTGG - Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005671767 6:28113563-28113585 AAAGAAAAGGGGAAAGGGGTCGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006070770 6:31496660-31496682 AAAAAAAAGGAAAAAGGGTCCGG - Intronic
1006185144 6:32177335-32177357 AATTATAAAGAGGAAAGGGCGGG + Intronic
1006504287 6:34478047-34478069 AAAAAAAAGGATAAAGGGGCTGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007647456 6:43393976-43393998 AAGAAAAATGAGTAAGGGGCTGG + Intergenic
1007668205 6:43529222-43529244 AATTATAAGGAGAATGGTGAAGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007906645 6:45467927-45467949 AACTTTAAGGAGAAAGAGGCTGG - Intronic
1008150197 6:47940870-47940892 TATTAAAATGTGAAAGGGGGTGG + Intronic
1008179690 6:48313004-48313026 AAATAGAAGGAGGAAGAGGCAGG + Intergenic
1008264181 6:49403396-49403418 TATGAAAAGGAGAAAGGGAAAGG + Intergenic
1008328675 6:50218898-50218920 AAGAAAGAGAAGAAAGGGGCTGG - Intergenic
1009395992 6:63201783-63201805 AATTAAAAGGGGCAAGAGGCTGG + Intergenic
1010433042 6:75800305-75800327 AATTAAGAGGAGACAGGACCTGG + Intronic
1011083680 6:83515776-83515798 ATTAAAAAGTAGAAAAGGGCCGG - Intronic
1011134255 6:84082806-84082828 GACAAAAAGGAGAAAGGGGTGGG - Intronic
1011171632 6:84511183-84511205 AAATAAAATGGGAGAGGGGCTGG + Intergenic
1011388066 6:86818989-86819011 AACCAAATGGAGAAAGGGGAAGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1012334961 6:98044181-98044203 CATGAAAAAGAGAAAGGGGGAGG + Intergenic
1012342933 6:98151114-98151136 AATTAAAGGGAAAAAGAGGAGGG + Intergenic
1012788527 6:103661561-103661583 AAAGAAAAGGAGGAAGGGCCGGG - Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1012930408 6:105310532-105310554 GATTAAAAGGAGGGAGTGGCAGG - Intronic
1013041701 6:106440561-106440583 AAAGAAAAAAAGAAAGGGGCCGG - Intergenic
1013627654 6:111953484-111953506 AAAAAAAAGTTGAAAGGGGCAGG - Intergenic
1014121797 6:117734407-117734429 AGTAAAATGGAGAAAGAGGCTGG - Intergenic
1014340117 6:120194345-120194367 AATTAAAATGACAATTGGGCTGG + Intergenic
1014434897 6:121410166-121410188 TATTAAAAAGTGAGAGGGGCCGG + Intergenic
1014735877 6:125095788-125095810 CATTAAAAGGGGATAGGGACAGG - Intergenic
1015095642 6:129411934-129411956 AATAAAATGGAAAATGGGGCAGG + Intronic
1015158583 6:130125947-130125969 AATTAACAGAAGAAATGGGTGGG - Intronic
1015321692 6:131882496-131882518 AACAAAAAGGAGAAAAGGGAAGG - Intronic
1015411209 6:132895754-132895776 GATTAAAAGGAGAAACAGGCTGG + Intergenic
1015437677 6:133208410-133208432 AATTGGAAGGGGAAAGAGGCAGG - Intergenic
1015758663 6:136633593-136633615 AATCAGAAGGAAGAAGGGGCTGG + Intronic
1015957821 6:138616472-138616494 AAGTAAATAGAGAAAGGGGGAGG + Intronic
1016160480 6:140873498-140873520 TAATAAAAAGAGAAATGGGCCGG + Intergenic
1016452519 6:144197881-144197903 ACTTGACAGGAGAAAGAGGCTGG + Intergenic
1016873498 6:148841806-148841828 AATTAAAAGCCAAAGGGGGCTGG + Intronic
1017003144 6:150009864-150009886 AATTATCAGGAAAATGGGGCTGG - Intergenic
1017483524 6:154881653-154881675 AAATAAAAAAAGAAAGAGGCAGG + Intronic
1017654688 6:156616311-156616333 AATAAAAAATAGAAAGGGCCAGG + Intergenic
1018813912 6:167316982-167317004 GACTAGAAGGAGAAAGGGCCAGG - Intergenic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019564260 7:1671732-1671754 AATTAAAAGGTGGCAGGGGCAGG - Intergenic
1019768103 7:2866097-2866119 AAATAAAAGAAAAAAGGGCCAGG - Intergenic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020203091 7:6095371-6095393 AATTAAATGGCCAGAGGGGCCGG + Intergenic
1020263633 7:6545913-6545935 AATTCAAAGGAGAACATGGCTGG + Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021298195 7:18935949-18935971 AAGTAAAAGTACAAAGGGGCAGG + Intronic
1021301687 7:18981118-18981140 TATTAAAAGAAGAAACAGGCCGG - Intronic
1021316003 7:19147708-19147730 AAGAAAAAGGAGTAAGGGGGAGG - Intergenic
1021613445 7:22479254-22479276 AAACAAAAGGAGATAGGGGTAGG + Intronic
1021724247 7:23534196-23534218 AAATAAAAGGAAAAAAGGGTAGG - Intergenic
1022132245 7:27415355-27415377 TATTAAAAGGAAAGAGGGACAGG + Intergenic
1022298483 7:29080261-29080283 TTTTAAAAAAAGAAAGGGGCTGG + Intronic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1023879908 7:44312449-44312471 AAGTGAAAGGAGAAAGGAGAGGG + Intronic
1024558784 7:50626626-50626648 AAGTACTAGGGGAAAGGGGCTGG + Intronic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1025930247 7:65987800-65987822 ATTTAAAGGGAAAAAGAGGCCGG + Intergenic
1026057388 7:66996564-66996586 AATTAAAAGAGGAAAGGAGCGGG - Intronic
1026205741 7:68255663-68255685 AAAGAAAAGGAGAAAGGAGCAGG - Intergenic
1026720721 7:72828468-72828490 AATTAAAAGAGGAAAGGAGTGGG + Intergenic
1026832772 7:73620442-73620464 TATTAAAAGAAGAAAAGAGCTGG + Intronic
1026917838 7:74132857-74132879 AAAAAAAAGAAGGAAGGGGCCGG - Intergenic
1026967759 7:74451251-74451273 AAAGAAAAAGAGAAAGAGGCAGG + Intergenic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027410548 7:77913089-77913111 ATTTAAAAAGAGATAGAGGCTGG + Intronic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1027830290 7:83168642-83168664 AATAAAAGGGAGAAAGGAGTAGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028607811 7:92674073-92674095 AAAAAAAAGAAGAAAGGGGGAGG - Intronic
1028867338 7:95729117-95729139 AATGAAAAGAAAAAAGGGTCAGG + Intergenic
1029099116 7:98113554-98113576 ATTTTAAATGAGAAAGGGCCAGG - Intronic
1029282802 7:99447528-99447550 AATTAAAAGGGGGGAGGTGCTGG - Intronic
1029545760 7:101209835-101209857 TCTTAAAAGAAGAATGGGGCTGG - Intronic
1031289994 7:119922213-119922235 AATTCACAGGAAAAAGGGGTGGG + Intergenic
1031398822 7:121306460-121306482 AATTAAAAGGAGAAAGAAAGAGG + Intergenic
1031911899 7:127526089-127526111 AATTAAAAAGAGAAAGAGAGGGG - Intergenic
1031925036 7:127630881-127630903 ATTAAAAAGAAGAGAGGGGCCGG - Intergenic
1032133743 7:129254977-129254999 CATTAAAAGTAAAAAGGGCCGGG + Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032553927 7:132812101-132812123 AATGAAAGGGGGAAAGGGGGAGG - Intronic
1032845332 7:135747298-135747320 AATTAAAAAAAGAAAAGGGAGGG + Intronic
1033508127 7:142026523-142026545 AATTAATAGGTGAAAGGGAATGG + Intronic
1033549422 7:142433075-142433097 AAATAAAAGGAGTTAGGGGATGG - Intergenic
1033681009 7:143596640-143596662 AATTTAATGGAGAAGGGGGGGGG - Intergenic
1033703883 7:143865173-143865195 AATTTAATGGAGAAGGGGGGGGG + Intronic
1034008533 7:147502831-147502853 AATTAAAAAAAGAAAGTAGCAGG + Intronic
1034499610 7:151440951-151440973 AGATCAAAGGAGAGAGGGGCAGG + Intergenic
1034613978 7:152398695-152398717 ACTTAAAAAGTAAAAGGGGCTGG - Intronic
1034864267 7:154627491-154627513 ACTTAAAAGGAAAAAAGGCCGGG - Intronic
1035220864 7:157405862-157405884 AATGAAAAAGAGAAAGTGGCTGG - Intronic
1035350721 7:158244308-158244330 AATTAAAAGGTGAAAGGTCAAGG + Intronic
1035655683 8:1303099-1303121 AATAAAAAGGAGGAAGGGGTGGG + Intergenic
1036527756 8:9551081-9551103 AAGTAAAAGGAGATAGTGGGTGG + Intergenic
1036581587 8:10080508-10080530 AATTAAAAAGAGACAGCTGCAGG - Intronic
1036912299 8:12767447-12767469 AATTAAAAAAAAAAAGTGGCTGG + Intergenic
1036965078 8:13288733-13288755 CAATAAAGGGGGAAAGGGGCAGG - Intronic
1037017316 8:13924896-13924918 AATTTAAAGGGGAAAAGGGTGGG + Intergenic
1037843404 8:22261741-22261763 AAATAAAAGGAGAAAGAGAATGG + Intergenic
1037874131 8:22530534-22530556 AATAAAAAGGAAGAATGGGCCGG + Intronic
1037904949 8:22710785-22710807 AATTAAAAGCAGAAGAGGGGAGG + Intergenic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1037994542 8:23342725-23342747 AATTAAAAGAAAAAAAAGGCCGG - Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038484937 8:27928158-27928180 AATTAAATGAGGAAAGAGGCTGG - Intronic
1038648746 8:29383258-29383280 AATGAAAAGGAGAACGTGACAGG + Intergenic
1039298942 8:36188558-36188580 AATTATTTGGGGAAAGGGGCAGG + Intergenic
1039300333 8:36202192-36202214 ATTTAAAAAGAAATAGGGGCTGG - Intergenic
1039459193 8:37729172-37729194 AAAGAAAAGAAGGAAGGGGCAGG + Intergenic
1039476208 8:37840647-37840669 AATTTAAAGGGGAAAGAGGATGG + Intronic
1039564173 8:38538078-38538100 AACTACAAGCAGAAAGGGGGAGG - Intergenic
1039841530 8:41296768-41296790 AATTAAAAGGAGAACGCGTTAGG + Intronic
1040407862 8:47125733-47125755 GATTAAAAGGGGCAGGGGGCAGG + Intergenic
1040618111 8:49060607-49060629 AATTAAAAACAGAGATGGGCTGG - Intronic
1040641893 8:49344799-49344821 TATAAAAAAGAGAAAGGGGGTGG - Intergenic
1040727188 8:50395805-50395827 AATTAAAACCAGAAATGGGCCGG - Intronic
1040815289 8:51501781-51501803 ATTAAAAAGGAGGTAGGGGCTGG + Intronic
1042161373 8:65899298-65899320 ACATAAAAGGAGAATGGGCCAGG - Intergenic
1042247680 8:66724274-66724296 TTTTAAAAGGAGAAATAGGCTGG - Intronic
1042552284 8:70004815-70004837 AAAGAAAAGGAAAAAAGGGCCGG + Intergenic
1042732233 8:71948781-71948803 AATGAAAAGAAGGAAGGGGGAGG + Intronic
1043160211 8:76837554-76837576 TATTAAAGGGAAATAGGGGCTGG + Intronic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044489880 8:92800806-92800828 AAATGAATGGAAAAAGGGGCTGG - Intergenic
1044529453 8:93290930-93290952 TATTATAAGAAAAAAGGGGCCGG - Intergenic
1044720363 8:95139717-95139739 AATAAACTGGAGAAAGGGGGTGG - Intronic
1045326589 8:101121949-101121971 AATAAGAAGGAGAAATGAGCTGG - Intergenic
1045460244 8:102419096-102419118 AATGCAAAGGAGAGAGTGGCAGG - Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045917307 8:107487263-107487285 AATAAAAAGGAGAGACAGGCCGG + Intronic
1046605218 8:116364248-116364270 AATTAAAAGTAGAAATTTGCTGG + Intergenic
1046956339 8:120066438-120066460 AATGAAAAATGGAAAGGGGCCGG + Intronic
1047469712 8:125158260-125158282 AATGCAATGGAGAAAGGGCCTGG - Intronic
1047893371 8:129337725-129337747 ACTTAAAAGGTAAAAGGGGCTGG - Intergenic
1048158736 8:131991458-131991480 AATGAATAGGAAAAAGTGGCTGG + Intronic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1050518733 9:6474407-6474429 GATTAAAAGGAGAAATGGGCTGG + Intronic
1050562222 9:6845708-6845730 GCATGAAAGGAGAAAGGGGCCGG + Intronic
1050906285 9:11011165-11011187 AAGTCAAAGGAGAAAGGGCAAGG + Intergenic
1050992948 9:12174980-12175002 GAGGAAAAGGAGAAAGGAGCAGG + Intergenic
1051246712 9:15119098-15119120 AATGAAAAGGAAGATGGGGCTGG + Intergenic
1051303856 9:15686286-15686308 AACTAAAATGAGATAGGGTCTGG - Intronic
1051357466 9:16253062-16253084 CATTAAAAGTAAAAAGGGGTTGG - Exonic
1051647055 9:19279377-19279399 AATAAAAATGAGCAAGGGCCCGG + Intronic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1052052082 9:23860082-23860104 AACCAAAAGGAGAAAAAGGCAGG - Intergenic
1052910250 9:33874595-33874617 AATAAAATGGAGGAGGGGGCGGG - Intronic
1053103096 9:35388018-35388040 AATTAACTAAAGAAAGGGGCTGG + Intronic
1053186683 9:36022325-36022347 AATTAAAAGTAGAAATGTGGGGG - Intergenic
1054856225 9:69902213-69902235 AATTAAAAAAACAAAGGGGAAGG - Intronic
1055111154 9:72561016-72561038 AATTAAAGAGAGAAAAGGCCGGG + Intronic
1055381894 9:75716388-75716410 AATGCAAAGGAGAAAGGGTGTGG - Intergenic
1056089548 9:83191464-83191486 AATGAAAAGGAGAAAGCCACTGG + Intergenic
1056390748 9:86139403-86139425 AATAAACAGCAAAAAGGGGCTGG + Intergenic
1057068306 9:92074902-92074924 AAGTAAAGGCAAAAAGGGGCTGG - Intronic
1057150797 9:92794265-92794287 GATTAAAGGGAGCAAGGGGTGGG + Intergenic
1057266232 9:93619798-93619820 GGTTAAAAAGGGAAAGGGGCCGG + Intronic
1057750032 9:97785203-97785225 AATTAAAAGAGGCAAAGGGCTGG + Intergenic
1057777468 9:98022484-98022506 AAAGAAAAAGAAAAAGGGGCTGG - Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058728788 9:107829416-107829438 AAGGAAAAGGAGAAAGGGTAGGG - Intergenic
1058965165 9:110030712-110030734 AATAAAAAGGGCAAGGGGGCAGG - Intronic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1061013945 9:127971343-127971365 AATGGAAAGGAGGAGGGGGCTGG - Intronic
1061057355 9:128231495-128231517 AATCAAAAGGCAAAAGTGGCCGG - Intronic
1061111357 9:128573748-128573770 AAAAAAAAGTAGAAAAGGGCTGG - Intronic
1061546397 9:131307254-131307276 AAAAAAAAGGAAAAAGGGCCGGG + Intronic
1185595236 X:1302299-1302321 AATTGAAAAGGGGAAGGGGCAGG + Intronic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185775443 X:2799418-2799440 AATTTAAAGGGGAAAGGGTGGGG + Intronic
1185876693 X:3707688-3707710 AATGAAGAGGAGAAACCGGCAGG + Intronic
1185931215 X:4205534-4205556 AATTAACATGAGATTGGGGCAGG - Intergenic
1186225043 X:7389452-7389474 AATGGAGAGGAGAAAGGAGCAGG + Intergenic
1186954119 X:14661573-14661595 ATTTAAAAGTAGAAAATGGCTGG + Intronic
1188101840 X:26097492-26097514 CATAAAAAGTAGAAAGGGGTGGG + Intergenic
1188432599 X:30121786-30121808 GTTTAAAATGAGAAAGAGGCAGG + Intergenic
1188464788 X:30467574-30467596 AAAAAAAAGGAGAAATGAGCAGG - Intergenic
1189029782 X:37438731-37438753 ATTAAAAAAGAGAAAAGGGCCGG - Intronic
1189385782 X:40535877-40535899 AGTTAAAAATAAAAAGGGGCTGG + Intergenic
1189839397 X:45057298-45057320 AAGTAAAAGGAGAAAAGAGCTGG - Intronic
1190819203 X:53957785-53957807 AAGCAAAAGGAAAAAGGGACAGG - Intronic
1190825822 X:54017152-54017174 TATTAAAAGGAGAAGGGGCTGGG + Intronic
1192371172 X:70514299-70514321 AGTTAAAAGGAGAAAGGGCCGGG + Intergenic
1192447109 X:71219413-71219435 AATTAAAAGGAGGCAGAGGTAGG - Intronic
1192581872 X:72289873-72289895 AATTTAAAGGAGGAGGGGGCCGG - Intronic
1193454171 X:81708999-81709021 AATTAATCGGAGAAAGAAGCTGG + Intergenic
1193973601 X:88089269-88089291 AATTGAAATCAGAAAAGGGCAGG - Intergenic
1194131155 X:90084034-90084056 TATCAAAATGAGAAAGGGGTGGG + Intergenic
1194464359 X:94213903-94213925 AATTAAAAGAAGAAAAGGAAAGG + Intergenic
1194700985 X:97113074-97113096 CACTAAAAGGAAAAAGTGGCCGG - Intronic
1194806599 X:98336780-98336802 AATTGAAAACAGAAAAGGGCTGG + Intergenic
1195347639 X:103966361-103966383 AGTTGGATGGAGAAAGGGGCAGG + Intronic
1195359803 X:104072480-104072502 AGTTGGATGGAGAAAGGGGCAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195885257 X:109630705-109630727 ATTTACTGGGAGAAAGGGGCAGG - Intronic
1197816472 X:130503868-130503890 AGATAAAAAGAGAAAGCGGCCGG - Intergenic
1198212667 X:134530194-134530216 AGATAAAAGGAGAAGGCGGCCGG - Intergenic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1198383383 X:136105083-136105105 AAGGAAAAGGAGGAAGGGGAGGG + Intergenic
1198466087 X:136906017-136906039 AATAAAAATGAAAAAGTGGCCGG - Intergenic
1198661110 X:138968442-138968464 AATAAAAAGGAGAGAGGGATGGG - Intronic
1199910381 X:152280484-152280506 AATTAAAAGGAGAATAGCACAGG - Intronic
1200428114 Y:3045104-3045126 AATTCAATGGAGAAAGGTACTGG - Intergenic
1200788668 Y:7280710-7280732 AATGAAGAGGAGAAACCGGCAGG - Intergenic
1200947293 Y:8856868-8856890 AATTAAAAAGAAAATGGGCCGGG - Intergenic
1201144197 Y:11053914-11053936 AATTAAAAACAGAAATGGCCAGG - Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201594592 Y:15653610-15653632 AATGGAGAGGAGAAAAGGGCAGG + Intergenic
1201734937 Y:17249117-17249139 AATTAAAAAGAGAGAAGGCCAGG + Intergenic
1201852034 Y:18495609-18495631 AATTAAAAAGATAAAGGAGCTGG - Intergenic
1201881287 Y:18824771-18824793 AATTAAAAAGATAAAGGAGCTGG + Intronic