ID: 1051799537

View in Genome Browser
Species Human (GRCh38)
Location 9:20916878-20916900
Sequence CTCTAACCCTGCAATAAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051799537_1051799538 4 Left 1051799537 9:20916878-20916900 CCATCTTTATTGCAGGGTTAGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1051799538 9:20916905-20916927 GCTGACTGATGAGATCACCAAGG 0: 1
1: 0
2: 1
3: 21
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051799537 Original CRISPR CTCTAACCCTGCAATAAAGA TGG (reversed) Exonic
904833969 1:33323152-33323174 ATCTAAGCCTTGAATAAAGAAGG - Intergenic
908132922 1:61094163-61094185 CTCTAACCCTTAAATAACCATGG - Intronic
914450062 1:147783407-147783429 CTCCATCCCTGCAATGAGGATGG + Intergenic
916300333 1:163266773-163266795 CTCTTTCCATGCAATCAAGAGGG - Intronic
919370308 1:196716234-196716256 TTCTAACCCTGAAAAATAGATGG - Intronic
921075124 1:211694530-211694552 CTCAAACTCTGAATTAAAGAAGG - Intergenic
922617610 1:226972048-226972070 CTCTAAACCTGCAAGACTGAAGG - Intronic
923177685 1:231483359-231483381 CTCTGACCCTGTAACAAAGATGG - Intergenic
923393389 1:233536070-233536092 CTCTAAATTTGCAATTAAGAGGG - Intergenic
1067084908 10:43232792-43232814 TTCTCACACTGCTATAAAGAAGG - Intronic
1068958442 10:62843125-62843147 CTCTAAACCAGCACTAAAGGTGG + Intronic
1071746064 10:88420921-88420943 CTATAACCCTAAAATAGAGAGGG + Intronic
1079065869 11:17291693-17291715 CTCTAAACCTGAAATCAAGGAGG + Intronic
1084799805 11:71535811-71535833 CAATAACCCTACAATAAAGTGGG + Intronic
1090447132 11:126774246-126774268 CTCTAACCCTGCAGGAAAATAGG + Intronic
1093764203 12:22943745-22943767 CTCTAACTCAACAATAAAGATGG - Intergenic
1094519849 12:31174950-31174972 CTCTGTGTCTGCAATAAAGAAGG + Intergenic
1095530144 12:43177622-43177644 CTGTAATCCTGCAATTAAGTTGG + Intergenic
1099715073 12:86281638-86281660 CTGTATCCCAGCAATTAAGAAGG - Intronic
1100889848 12:99113097-99113119 CTAAAACACTGCATTAAAGAGGG - Intronic
1103394987 12:120600431-120600453 CTCTATCCCTGCAAAATAGTGGG - Intergenic
1104902591 12:132197445-132197467 CGCTAGCCCTGCAGGAAAGATGG - Intronic
1105386836 13:19938204-19938226 CTAGATCCCTGAAATAAAGATGG + Intergenic
1105717398 13:23081099-23081121 CTCTAGCCCTGGAATGAGGAGGG - Intergenic
1105970415 13:25424650-25424672 CTTAAACCGTTCAATAAAGATGG + Intronic
1107939783 13:45373408-45373430 CTCTAAGCCAGCAACATAGAAGG - Intergenic
1110375201 13:74785609-74785631 CTGTTTCCCTGCAATAAAAAGGG - Intergenic
1112468509 13:99666957-99666979 CTCTCACCCTGCATAGAAGACGG + Intronic
1113162408 13:107396752-107396774 CTCTCACCCTGCAGTAGAGATGG + Intronic
1113775280 13:112941091-112941113 CTCTGACCCTGCGGAAAAGATGG - Intronic
1115374921 14:32664005-32664027 CTCTAGCCCAAAAATAAAGAAGG + Intronic
1117020076 14:51561295-51561317 CCCTAACCCTGTAACAAAGAAGG + Intronic
1117090235 14:52242990-52243012 CTTTATCCATGAAATAAAGAGGG + Intergenic
1117603323 14:57398200-57398222 CTGTAACACTGCAATAAAGTTGG - Intronic
1120781852 14:88492649-88492671 CTCACACCCTGCAAGACAGAAGG + Intronic
1121163439 14:91768358-91768380 CAGTGACCCTGCAATAAAAATGG + Intronic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1123965098 15:25448028-25448050 TTCTAAGCCTGCAATCATGAGGG - Intergenic
1124352562 15:28968546-28968568 CTCTAATCCTGCGAAAGAGACGG - Intronic
1126851116 15:52797921-52797943 CTGAAACCCCGCAATAAAAACGG + Intergenic
1127405728 15:58643581-58643603 CTCTGACCCTTCAATAACTATGG - Intronic
1127812220 15:62574010-62574032 CCTTAACCCTGCACCAAAGATGG - Intronic
1128849528 15:70939149-70939171 CTCTAACACTGCAATAATAGTGG - Intronic
1128902324 15:71435829-71435851 CACTAACCAGGCAACAAAGATGG + Intronic
1129179591 15:73865601-73865623 ATGTAACCCTGCAATAATGGGGG + Intergenic
1132542124 16:515301-515323 CTCTAACCCTGGAGTCCAGACGG - Intronic
1134658161 16:15963453-15963475 CTCTACCAATGCAGTAAAGAAGG - Intronic
1143674248 17:8419782-8419804 CTCTGACCCAGCAACAAACATGG - Intronic
1144647165 17:16982969-16982991 CTCAAATCCTGCAACATAGAAGG - Intergenic
1145013989 17:19385112-19385134 CTCAAAGCCTGCCACAAAGAGGG + Exonic
1146894666 17:36532876-36532898 CCCTAACCCTGTAATAAAACTGG - Intronic
1148505287 17:48122272-48122294 CTCTAACCCTGCGGAAAAGATGG - Exonic
1150032589 17:61755041-61755063 CTCTCACCCTGGAATACAAAAGG + Intronic
1151821522 17:76499580-76499602 CTTTTGTCCTGCAATAAAGAGGG - Intronic
1152791216 17:82281153-82281175 CTCTAACCCAGCAAGGAAGTTGG - Intergenic
1156179264 18:34583864-34583886 CTCTCACCCTGTAAGAGAGATGG + Intronic
1156528837 18:37795537-37795559 CTCTAAAGATGCAATAAACATGG - Intergenic
1158810520 18:61028533-61028555 CTCTAACTATTCAATAAAGGTGG - Intergenic
1159900180 18:74038243-74038265 CTCTGTCCCTGCACTGAAGAAGG + Intergenic
1160331136 18:77992573-77992595 CCCTGAACCGGCAATAAAGAGGG + Intergenic
1163192040 19:15684266-15684288 CTTTCACCCTGTAATAAAGAAGG - Intronic
1163201188 19:15770468-15770490 CTTTCACCCTGTAAAAAAGAAGG + Intergenic
925471569 2:4167702-4167724 CTATAAACCAGCAATAAACAGGG - Intergenic
927716076 2:25354064-25354086 CTGTTACCCAGCAATACAGAGGG - Intergenic
928919139 2:36507823-36507845 TTCTGGTCCTGCAATAAAGAAGG - Intronic
931177481 2:59868553-59868575 CTCTAACCACGCATTCAAGAAGG + Intergenic
931772775 2:65512997-65513019 CTGTGACCATGCAAGAAAGAAGG + Intergenic
937630716 2:124098178-124098200 CTCTATTCTTACAATAAAGAAGG + Intronic
942762734 2:179418886-179418908 GACTAATCCTGCAATAAACATGG - Intergenic
942978274 2:182046152-182046174 CTCTTACCATGAAATAAAGGAGG - Intronic
946497053 2:220205412-220205434 CTATAATCCAGCAATAAATATGG - Intergenic
948507002 2:238435209-238435231 CTCTAACACTGCACAAATGATGG - Intronic
948790882 2:240376284-240376306 CTCTGCCCATGTAATAAAGATGG - Intergenic
1168940128 20:1702925-1702947 CTCTTACCCTTCATGAAAGAGGG + Intergenic
1170450738 20:16480977-16480999 CTACAACCATGCAATAAACATGG + Intronic
1170538864 20:17368467-17368489 ATCTAACCCTCCAAGAAACAGGG - Intronic
1177250008 21:18580745-18580767 CTATCACTCTGCAATAAAGTAGG - Intergenic
952190098 3:31014069-31014091 CTCTGAGACTGCACTAAAGAGGG + Intergenic
952870134 3:37891512-37891534 CTCTAAGCCTGCAGTAAAAGAGG - Intronic
953224048 3:41000052-41000074 CTCGAACCCTGCAAGATGGATGG - Intergenic
963093333 3:141507967-141507989 TTCTAAACCTGCAGTAAATATGG - Intronic
964632005 3:158820983-158821005 TTCTAACCAAGGAATAAAGAGGG - Intronic
965231400 3:166057565-166057587 CTCTAAGCATGCTATAAAAATGG - Intergenic
966803757 3:183789280-183789302 CTCTCACCATGCAATCAAAATGG - Intronic
970209473 4:13693869-13693891 CTATAACGCTGCAAGAAACATGG - Intergenic
973852532 4:54975377-54975399 CTCTGACCCAGCAATCCAGATGG - Intergenic
975595954 4:76048384-76048406 CACTAACCCTGAAAAAGAGATGG - Intronic
977910635 4:102531371-102531393 CTATGACACTGCAATGAAGAGGG - Intronic
980393845 4:132182282-132182304 CTCAAACCATGCCAGAAAGACGG - Intergenic
982156633 4:152529485-152529507 CTCCACCCCTGCCATAAACAAGG + Intronic
982235239 4:153246002-153246024 CTCTAACACTACAATAAAATTGG + Intronic
982692247 4:158562155-158562177 CTCCAACCCCCCAATAAACACGG + Intronic
983252006 4:165355857-165355879 CTCTAAGACTGTAATACAGAAGG + Intergenic
987005731 5:13707392-13707414 CTCTGTCCTTGCGATAAAGAGGG + Intronic
993577553 5:89621156-89621178 CTGTAACTCTGCATTAAAAATGG - Intergenic
997914166 5:137907890-137907912 CTTTATCCATGCAAAAAAGATGG - Exonic
1002972478 6:2038034-2038056 CTTGAACCTTGAAATAAAGAGGG + Intronic
1006597761 6:35205986-35206008 CTGAAAACCTGCAATAAGGAAGG - Intergenic
1008168897 6:48177856-48177878 CACCAACCCTCCAATAAAAAAGG + Intergenic
1010735681 6:79441702-79441724 CTCAAAGCCTGCATTAGAGAAGG - Intergenic
1012433010 6:99185960-99185982 ATCTAACCCTGTAATTAGGATGG - Intergenic
1016234812 6:141851378-141851400 CTCCAACCCTTCAAAAAAGTTGG + Intergenic
1018947089 6:168355651-168355673 CCCTAATCAAGCAATAAAGATGG - Intergenic
1020594424 7:10186934-10186956 CTCTATACCTGGAAAAAAGAAGG + Intergenic
1020939351 7:14511011-14511033 CTCTAACTGTGCAATATAAATGG - Intronic
1021198641 7:17700579-17700601 CTCTGACCCTGTAATGATGATGG + Intergenic
1024782535 7:52867867-52867889 CTTTAACAGTGAAATAAAGATGG + Intergenic
1028396323 7:90372571-90372593 CTATAACCCAGCAATTTAGAAGG - Intronic
1028444887 7:90910669-90910691 CTCTGACACTACAATTAAGAGGG - Intronic
1029033698 7:97495486-97495508 TTCAAAGCCAGCAATAAAGAAGG - Intergenic
1030600389 7:111585038-111585060 CTCTAACACTGAAAAGAAGAAGG - Intergenic
1031951890 7:127901266-127901288 CTCATAGCCTGGAATAAAGATGG + Intronic
1032121445 7:129160041-129160063 CCCTCACCCCGCAAAAAAGAGGG + Intronic
1039399696 8:37259336-37259358 CTTTAACAATGCAATATAGATGG + Intergenic
1042007692 8:64200419-64200441 TTCTAACCCTGACATACAGAAGG + Intergenic
1043874543 8:85469686-85469708 CCCTAACTTTGCAATAAAGCAGG - Intronic
1044293812 8:90503771-90503793 CTCTAACCATGCATTACACAGGG + Intergenic
1050429584 9:5549128-5549150 TTCTTACAATGCAATAAAGATGG - Intronic
1050786631 9:9411884-9411906 CTATGACCCTGCAAGCAAGAGGG + Intronic
1051556287 9:18386117-18386139 CACTAGTCCTGCAACAAAGAGGG - Intergenic
1051799537 9:20916878-20916900 CTCTAACCCTGCAATAAAGATGG - Exonic
1052058727 9:23933795-23933817 CTCTACCCCTTCAATAAAAGGGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1058277731 9:103066253-103066275 CTCTAACACTGCTATACAAATGG - Intergenic
1059858674 9:118431991-118432013 ATTTAACCCTGGAATAAGGATGG + Intergenic
1186106692 X:6215222-6215244 CACTATCCCTGCAATGAAAAAGG - Intronic
1189795214 X:44639474-44639496 CTCTAACCCAGCACCAAACAAGG + Intergenic
1190576478 X:51844713-51844735 CTCTAAGCCAGGAATAGAGATGG + Intronic
1190970137 X:55340775-55340797 CACTAAGACTGCATTAAAGAAGG - Intergenic
1197964589 X:132045188-132045210 CTCTAACACTGTAATGAAGTGGG - Intergenic