ID: 1051799728

View in Genome Browser
Species Human (GRCh38)
Location 9:20918958-20918980
Sequence TAGCTACGGCTGCCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051799719_1051799728 11 Left 1051799719 9:20918924-20918946 CCACTGCCCGCTGCCAGCTTAGC 0: 1
1: 0
2: 1
3: 29
4: 304
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data
1051799722_1051799728 -2 Left 1051799722 9:20918937-20918959 CCAGCTTAGCTTCCCTTTCCTTA 0: 1
1: 0
2: 1
3: 33
4: 382
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data
1051799717_1051799728 28 Left 1051799717 9:20918907-20918929 CCAACATGAGGCCTTCACCACTG 0: 1
1: 0
2: 3
3: 14
4: 149
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data
1051799718_1051799728 17 Left 1051799718 9:20918918-20918940 CCTTCACCACTGCCCGCTGCCAG 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data
1051799721_1051799728 4 Left 1051799721 9:20918931-20918953 CCGCTGCCAGCTTAGCTTCCCTT 0: 1
1: 0
2: 3
3: 28
4: 275
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data
1051799720_1051799728 5 Left 1051799720 9:20918930-20918952 CCCGCTGCCAGCTTAGCTTCCCT 0: 1
1: 0
2: 0
3: 22
4: 268
Right 1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051799728 Original CRISPR TAGCTACGGCTGCCACAGGC TGG Intronic
No off target data available for this crispr