ID: 1051800259

View in Genome Browser
Species Human (GRCh38)
Location 9:20924809-20924831
Sequence TTTCATTAGTACCTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051800259_1051800260 2 Left 1051800259 9:20924809-20924831 CCAGGCAACAGGTACTAATGAAA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1051800260 9:20924834-20924856 TCTAAGCAGACCACCTCCAGTGG No data
1051800259_1051800261 3 Left 1051800259 9:20924809-20924831 CCAGGCAACAGGTACTAATGAAA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1051800261 9:20924835-20924857 CTAAGCAGACCACCTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051800259 Original CRISPR TTTCATTAGTACCTGTTGCC TGG (reversed) Intronic
900039895 1:451232-451254 TTTCATTTCTGGCTGTTGCCTGG - Exonic
900061327 1:686208-686230 TTTCATTTCTGGCTGTTGCCTGG - Exonic
901948868 1:12725557-12725579 TTTCATGATGACCTCTTGCCAGG - Exonic
908051033 1:60230750-60230772 TTTCATCTGTACCTGCAGCCTGG + Intergenic
914977658 1:152380662-152380684 TTTACATTGTACCTGTTGCCTGG + Intergenic
916382539 1:164228333-164228355 TTTCATTAGGAAAAGTTGCCTGG - Intergenic
916943716 1:169702778-169702800 TTGCTTTAGCACCTATTGCCAGG + Intronic
918409882 1:184247499-184247521 TTTCATTAGTGCCTGCTATCTGG + Intergenic
922640620 1:227227240-227227262 TTTTTTTAGTAGCTGTTGACGGG - Intronic
1067803088 10:49373292-49373314 TTTCATTAGTATCTTTTTCATGG - Intronic
1071844126 10:89504337-89504359 TTTCCTTATTACCTGTTCCCTGG + Intronic
1071846408 10:89525675-89525697 TTAAGTTAGTAGCTGTTGCCAGG + Intronic
1074103472 10:110372130-110372152 TTTCATTAGTTTCTGCTACCTGG + Intergenic
1074867525 10:117553611-117553633 GTTTATTAGTGTCTGTTGCCCGG + Intergenic
1076966119 11:87141-87163 TTTCATTTCTGGCTGTTGCCTGG - Intergenic
1077358744 11:2130405-2130427 TTTCATCTGTCCCTGTTGCTTGG - Intronic
1078643217 11:13115024-13115046 GTTCCTTTGTGCCTGTTGCCTGG - Intergenic
1082962664 11:58934281-58934303 CTTCATTAGACCCTGTTGCTAGG - Intronic
1084868347 11:72078957-72078979 TCTCTCTAGTATCTGTTGCCTGG - Intronic
1088587402 11:111371280-111371302 TTTCATTAGTACCACTTTCTGGG - Intronic
1088990644 11:114950470-114950492 ATTACTTTGTACCTGTTGCCTGG - Intergenic
1089064059 11:115649057-115649079 TGTCATTAGTACCTGATACAGGG - Intergenic
1092812652 12:12286156-12286178 TTTAATAATTACCTTTTGCCTGG - Intergenic
1093539409 12:20263746-20263768 TTTCATGAGTTCTGGTTGCCTGG + Intergenic
1095826562 12:46536063-46536085 TGCCGTTAGTACCTGTTGACAGG - Intergenic
1097722582 12:63039408-63039430 TTACATGAGGACCTGATGCCTGG - Intergenic
1098816967 12:75178131-75178153 TTTCATTAGTATTTCATGCCAGG - Intronic
1100394871 12:94176322-94176344 TTCCATTAGTGCCTGTGGGCTGG + Intronic
1100984757 12:100193201-100193223 TTTTATTAATATCTGTTCCCTGG + Intergenic
1107185636 13:37516406-37516428 TTTCAATAGTATCTGTTGTGTGG - Intergenic
1110605384 13:77426371-77426393 TTGCATAAATAACTGTTGCCTGG + Intergenic
1111292377 13:86186257-86186279 TTTACATTGTACCTGTTGCCTGG - Intergenic
1114244228 14:20897735-20897757 TCTCATTATTAGCTGTGGCCTGG - Intergenic
1115196725 14:30808548-30808570 CTTCATTAGTAGCTGTGTCCTGG - Intergenic
1117127711 14:52648217-52648239 TAAAATTAGTACCTGTTGCTTGG - Intronic
1117127849 14:52650459-52650481 TAAAATTAGTACCTCTTGCCTGG - Intronic
1117857318 14:60049419-60049441 TTTCTTCAGGACCTGTTGCAAGG + Intronic
1119451621 14:74716783-74716805 TTTCATTCGTACCTCTAACCGGG - Intronic
1124411066 15:29437659-29437681 TTTCATTAGTGCCTGTAGGTTGG + Intronic
1130319806 15:82831979-82832001 TTTCATTTGTACCTGGTTCTAGG - Intronic
1132442012 15:101876387-101876409 TTTCATTTCTGGCTGTTGCCTGG + Intergenic
1133104091 16:3495513-3495535 TGTCATAAGAACCAGTTGCCAGG - Intergenic
1135781431 16:25305128-25305150 TTTCAATAGTACCTTTTTCTTGG + Intergenic
1137811502 16:51357104-51357126 TTTGATTAGCACCTGTGGGCTGG + Intergenic
1140768022 16:78177953-78177975 TTTCAATAGTTCCTGTTGTGAGG + Intronic
1142677926 17:1526618-1526640 TTGCATTAGTAACTGAAGCCAGG - Intronic
1144091414 17:11860254-11860276 TTGCATTAGTTCCTTTTGCATGG + Intronic
1151395201 17:73818709-73818731 TTTCAGGAGCACCTGTTACCTGG - Intergenic
1153793999 18:8606116-8606138 TTTCATTTTTCCCTTTTGCCCGG - Intergenic
1160642921 19:156771-156793 TTTCATTTCTGGCTGTTGCCTGG - Intergenic
1164884856 19:31769868-31769890 TTTCGTTAGTATCTGTTCCCAGG - Intergenic
927340625 2:21979765-21979787 TTTCATTATTACTTGTAGCTAGG - Intergenic
927627997 2:24744188-24744210 TATCATGAGTATCTGGTGCCTGG + Intronic
930144514 2:47987789-47987811 GTTCATCAGTCCCTGTTCCCAGG + Intergenic
930805958 2:55490798-55490820 GTTCATGAGCAGCTGTTGCCAGG + Intergenic
932440517 2:71731738-71731760 TTTCATGGGTCCCTGTGGCCTGG + Intergenic
932740664 2:74288564-74288586 TTTCCCTAGTTCCTCTTGCCTGG + Intronic
948648497 2:239424382-239424404 TTTAATTGGTACCTGGTACCTGG + Intergenic
1169598255 20:7226055-7226077 TAACATCAGTGCCTGTTGCCTGG - Intergenic
1174749879 20:53101022-53101044 AGTCATTAGTACCTTTTACCTGG + Intronic
1174961805 20:55166177-55166199 GTTCAGTAGTACCTTTTGGCAGG + Intergenic
1176415633 21:6473101-6473123 TAGCATTAGTAACTGTAGCCGGG - Intergenic
1179691133 21:43081433-43081455 TAGCATTAGTAACTGTAGCCGGG - Intergenic
1180135261 21:45858196-45858218 TTACTGTAGGACCTGTTGCCTGG + Intronic
952796359 3:37242855-37242877 TTTCTTTAGTAGCTGTAGCTAGG - Intergenic
955946383 3:64198549-64198571 TGTCATTATTAACTGTTACCAGG - Intronic
963944807 3:151134292-151134314 TTTCATTAGTAAATGTTTGCTGG + Intronic
964739738 3:159952849-159952871 TTGCATTTGTTCCTTTTGCCTGG - Intergenic
965477840 3:169179361-169179383 TTTAATTATTCCCTGTTGACTGG - Intronic
967019347 3:185508779-185508801 TTGCAGTTGTAACTGTTGCCAGG - Exonic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
978089424 4:104696066-104696088 TTTCATAAGAACCTGGTGTCTGG + Intergenic
983238579 4:165207204-165207226 TTTCATTTGTGCCTGTACCCAGG - Intronic
983762354 4:171426624-171426646 TTGCATTTCTAGCTGTTGCCAGG - Intergenic
984601240 4:181729436-181729458 TCTCATTAGTTCCTGTGACCCGG - Intergenic
986032531 5:3907718-3907740 GTTAATTAGTACCTGTTTACTGG - Intergenic
986539096 5:8825396-8825418 TTCCATAAGTACCAGTTGTCTGG - Intergenic
991920854 5:71655444-71655466 TTTCATTAGTGCCTCTTACCTGG + Intronic
997618786 5:135271622-135271644 TTTCATTAGCACCATTTGGCAGG + Intronic
1002733952 5:181367711-181367733 TTTCATTTCTGGCTGTTGCCTGG + Exonic
1002750591 6:106411-106433 TTTCATTTCTGGCTGTTGCCTGG - Intergenic
1005774271 6:29112968-29112990 TTTTATTCCTACCTGTTACCAGG - Intergenic
1005780165 6:29182587-29182609 TTTTATTCCTACCTGTTACCAGG - Intergenic
1006020036 6:31112421-31112443 TTTCCTTAATTCCTGTTTCCTGG + Intronic
1006367918 6:33626444-33626466 TTTAATGAGTACCTGGGGCCGGG + Intronic
1009546446 6:65026409-65026431 TTTCATGAGTCCCTTTGGCCTGG - Intronic
1011326092 6:86151152-86151174 TTTACGTAGTGCCTGTTGCCTGG + Intergenic
1013498013 6:110718193-110718215 TTTCATTTGTTCCTGGTACCTGG - Intronic
1013506405 6:110804658-110804680 TTTTATAAAGACCTGTTGCCGGG + Intronic
1015060122 6:128953244-128953266 TTTCAATTGAACCTGTTTCCTGG + Intronic
1015431882 6:133141526-133141548 AGTCATAACTACCTGTTGCCCGG + Intergenic
1019238199 6:170640029-170640051 TTTCATTTCTGGCTGTTGCCTGG + Intergenic
1023154655 7:37236640-37236662 ATTCATTAGGACCGGTTGCTGGG + Intronic
1024532591 7:50406078-50406100 TTTAATTGCTACCTGTGGCCAGG - Intergenic
1027538519 7:79438088-79438110 TTACAGTAATAGCTGTTGCCTGG - Intronic
1030647978 7:112085459-112085481 ATTCATTACTGCCGGTTGCCAGG + Intronic
1031199746 7:118665855-118665877 TCACATAAGTACCTATTGCCGGG - Intergenic
1032563020 7:132912300-132912322 TCTGGTTAGTAACTGTTGCCTGG + Intronic
1033398507 7:140999209-140999231 TTACAGTAGTACCTGTAGCTGGG + Intergenic
1033690222 7:143729030-143729052 TTTCTCTAGTACCCTTTGCCAGG + Intronic
1033901331 7:146144507-146144529 TTTCATTCCTTCCTGTTCCCAGG + Intronic
1035509568 8:166578-166600 TTTCATTTCTGGCTGTTGCCTGG - Exonic
1037188432 8:16092765-16092787 TTCCATTAGTCCCAGTTGTCAGG + Intergenic
1038306889 8:26413147-26413169 TTTCTGTCGCACCTGTTGCCTGG + Intronic
1039297377 8:36171073-36171095 TTTTTTTAGTATCTGTTGCCTGG + Intergenic
1040136586 8:43861452-43861474 TTTCACAGGTACCTTTTGCCTGG - Intergenic
1041887418 8:62826670-62826692 TCTCATTAGTACCTGCTGTTTGG + Intronic
1042735504 8:71983458-71983480 TTTCTTTAGTTCCTGCTCCCTGG - Intronic
1046571060 8:115966717-115966739 GTTGATTTGTAACTGTTGCCTGG + Intergenic
1047990895 8:130285356-130285378 GTTCACTAGTACCTGTAGGCTGG - Intronic
1050347696 9:4708899-4708921 TTTCATTTTTAGATGTTGCCAGG - Intergenic
1050439747 9:5649679-5649701 TTTTATTAGAATCTGTTGCTGGG + Intronic
1051422973 9:16906799-16906821 ATTCTTTAGTACATGTTGCATGG + Intergenic
1051800259 9:20924809-20924831 TTTCATTAGTACCTGTTGCCTGG - Intronic
1056135679 9:83627567-83627589 TTTCACTAGCACATGCTGCCTGG + Intronic
1056256337 9:84803219-84803241 TTTCTCTAGTGCCTGTTCCCAGG - Intronic
1056448196 9:86686945-86686967 TTTAATTAGTCTCTGTAGCCTGG - Intergenic
1058160091 9:101560808-101560830 TTTCCTTACTACCTGTAGCTGGG - Exonic
1058907211 9:109491588-109491610 TTGTATTAGTACCTGTCTCCCGG - Intronic
1058952008 9:109912824-109912846 CTTCATTAGTTCCTGCTGCCTGG - Intronic
1059354814 9:113690462-113690484 TTTCATGGGTCCCTGCTGCCCGG + Intergenic
1062758405 9:138320321-138320343 TTTCATTTCTGGCTGTTGCCTGG + Intergenic
1190032464 X:46987543-46987565 TTTCATTTGTTTCTTTTGCCAGG + Intronic
1190111402 X:47591308-47591330 TCTCATTAATTCCTGGTGCCTGG - Intronic
1190528283 X:51349849-51349871 TTTCAGTGGCACCTGCTGCCTGG + Intergenic
1190659332 X:52640408-52640430 TTTTATAACTACCTATTGCCTGG + Intergenic
1192086038 X:68098302-68098324 ATTCATTAGTACCTGCTGTGTGG - Intronic
1198115129 X:133537363-133537385 TTTCCTCTGTGCCTGTTGCCGGG - Intronic
1199143035 X:144334254-144334276 TTTACATTGTACCTGTTGCCTGG + Intergenic
1199242991 X:145569650-145569672 TTTCATTGGAACTTGTTGCTGGG - Intergenic
1201358659 Y:13122334-13122356 TTTCATTTCTATCTCTTGCCTGG + Intergenic
1202019272 Y:20448416-20448438 TTTGTATTGTACCTGTTGCCTGG - Intergenic