ID: 1051801863

View in Genome Browser
Species Human (GRCh38)
Location 9:20943845-20943867
Sequence TGGTAAGATAATGCAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051801863_1051801865 23 Left 1051801863 9:20943845-20943867 CCACAAGCTGCATTATCTTACCA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1051801865 9:20943891-20943913 GAACAATTATTTTCTTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051801863 Original CRISPR TGGTAAGATAATGCAGCTTG TGG (reversed) Intronic
902596542 1:17513561-17513583 TGGAAACAAAATGCAGGTTGGGG + Intergenic
903164877 1:21513292-21513314 TGGAAAGATCATGTAGCTTAAGG - Intronic
904405415 1:30285226-30285248 TGGGAAGATAAAGCAGCTTCCGG - Intergenic
907683123 1:56582667-56582689 TGGTAAGATTATTCAACTTTAGG - Intronic
909201552 1:72695442-72695464 TGTTAAGATAAGGGGGCTTGTGG + Intergenic
909365300 1:74813619-74813641 TTGTAAGTGAAAGCAGCTTGAGG - Intergenic
910128034 1:83867071-83867093 TGGTAAGATTAAGTAGCTTTTGG + Exonic
910536431 1:88303410-88303432 TGCTAAGATTCTGCAGCTTCAGG - Intergenic
913211229 1:116584294-116584316 TGTTGAGAAAATTCAGCTTGTGG - Intronic
913702807 1:121389751-121389773 TCCTTAGATAATGAAGCTTGGGG - Exonic
914043370 1:144070255-144070277 TCCTTAGATAATGAAGCTTGGGG - Intergenic
914134716 1:144890240-144890262 TCCTTAGATAATGAAGCTTGGGG + Exonic
919114261 1:193260847-193260869 AGGTAAGATCATTCATCTTGAGG + Intergenic
920490239 1:206408492-206408514 TCCTTAGATAATGAAGCTTGGGG - Intronic
921622226 1:217338035-217338057 TGGTGAGATAAGCCAGCATGAGG + Intergenic
924796064 1:247293123-247293145 TGGTTAGATAAAGGTGCTTGGGG - Intergenic
1065349789 10:24785223-24785245 TGGAAAGATATTGCAGGTAGAGG + Intergenic
1065988856 10:30987036-30987058 TGGTAATATATTGCAGTTTTGGG - Intronic
1066122586 10:32304323-32304345 TTATAAGATAATATAGCTTGTGG + Intronic
1068552024 10:58417265-58417287 TGGTAAGACAATAAAGCTTTAGG + Intergenic
1075302290 10:121335647-121335669 TGGTAAGAAAACACTGCTTGAGG - Intergenic
1075330829 10:121572851-121572873 AGGTAAATTCATGCAGCTTGTGG - Intronic
1078861508 11:15251741-15251763 TGGTAAAATAGTACAGCTGGTGG + Intergenic
1079394909 11:20053410-20053432 TGGTAAGATAATGCACATGAAGG + Intronic
1079860052 11:25657623-25657645 TGTTATGAAAATGCAGCTTCGGG - Intergenic
1081014390 11:37857896-37857918 TACTAAGATAAGGAAGCTTGGGG - Intergenic
1081351697 11:42061593-42061615 TGGTTAGATTCTGCAGCATGAGG - Intergenic
1083601254 11:63949686-63949708 AGGTAAGAAAATGAGGCTTGAGG - Intronic
1086432342 11:86747922-86747944 TGTTAAAATAATGCAGGTTTTGG + Intergenic
1088064090 11:105694445-105694467 TGTTAAGATAATTTAACTTGTGG - Intronic
1094430606 12:30365711-30365733 TGGTAAAATAATGCAGGTGAAGG + Intergenic
1096306107 12:50477879-50477901 TACTAAGATAATGCAGTTGGTGG + Exonic
1100318559 12:93467764-93467786 TGGGGAGGTGATGCAGCTTGTGG + Intronic
1100616517 12:96235401-96235423 TGGTAAGAAAACCCAGCATGCGG - Intronic
1111451924 13:88429889-88429911 ATGTAAGATAATACTGCTTGTGG + Intergenic
1111781198 13:92727164-92727186 CGCTAAGATAATGTAGCTCGGGG + Intronic
1112515715 13:100051164-100051186 AGTTAAGATAAAGCGGCTTGTGG + Intergenic
1113013631 13:105800569-105800591 TGGCAAGATAAAGCACCTTCAGG + Intergenic
1114742894 14:25116298-25116320 TGTTAAGATAAGGGGGCTTGTGG + Intergenic
1117780638 14:59228078-59228100 TGGTAAGAAAAAACAACTTGTGG - Intronic
1123483542 15:20660075-20660097 TGGTATGCTAATTCAGCTTAAGG - Intergenic
1124896852 15:33785462-33785484 TAGGAAGATAATGCAGCCTCTGG + Intronic
1125158961 15:36621633-36621655 TACTAAGATAATGCAGTTGGTGG + Intronic
1126852886 15:52808652-52808674 GGGAAATATAATGCAGCTTCTGG - Intergenic
1127918362 15:63473838-63473860 TGTTAATAGAATGCAGATTGCGG + Intergenic
1128393113 15:67196590-67196612 TGGGAAGATGATTCAGTTTGGGG - Intergenic
1130787863 15:87120165-87120187 TGGTAGGATAGTGGACCTTGAGG + Intergenic
1131790188 15:95956156-95956178 TGTTCAGAAAATGAAGCTTGGGG - Intergenic
1138218522 16:55227272-55227294 CTGTGAGATAATGCTGCTTGAGG + Intergenic
1139485634 16:67255217-67255239 TGGTCAGAGCATGCAGCCTGGGG - Intronic
1141915256 16:87092095-87092117 AGGTAAAATAATTCACCTTGGGG - Intronic
1144113052 17:12057510-12057532 TGGGAAGATGATGCAATTTGAGG - Intronic
1156041404 18:32827217-32827239 TGGTAAGATAATTCCGCCTTCGG + Intergenic
1156416602 18:36899906-36899928 TTGCAAGAAAATCCAGCTTGTGG + Intronic
1157750682 18:50175329-50175351 TTTTAGGATAAAGCAGCTTGTGG - Intronic
1158748535 18:60229771-60229793 TGGTGACATAATGCAGCTTTTGG + Intergenic
1159523642 18:69559596-69559618 TGGTAGGATAGTGCTGGTTGTGG - Intronic
1160046263 18:75390130-75390152 TGGAAAGGTAATGGAGCTGGAGG + Intergenic
1160359350 18:78258185-78258207 TGGTAAACTGATGCAGCATGGGG + Intergenic
1165461516 19:35946685-35946707 GGGTAAGAAAATGTAGCTAGAGG + Intergenic
927680052 2:25133053-25133075 GGGTCAGAAAATGCAGCTGGGGG - Intronic
930869770 2:56158904-56158926 TGGTAATCTTCTGCAGCTTGGGG + Intergenic
930924034 2:56794361-56794383 TGGAAAGATAATACAAGTTGAGG + Intergenic
932407300 2:71522014-71522036 TGGTGGGATAATGCAGCGGGAGG - Intronic
936067960 2:109346448-109346470 TGGTGAGAAAATGCGGCTTCTGG + Intronic
940596840 2:155805441-155805463 TGCTAAATTAATGCTGCTTGGGG + Intergenic
941313096 2:163958960-163958982 TGATAAGATAATGGAGCATGGGG + Intergenic
942286740 2:174425761-174425783 TGGAAAGATAATGGAATTTGAGG + Intronic
943478942 2:188394755-188394777 TGGTAACCTAATGCAGCTCTTGG + Intronic
944123066 2:196262368-196262390 TGGTAATATAATGAAGATTAAGG + Intronic
945986552 2:216359077-216359099 TGTTAAGACACTGAAGCTTGGGG - Intronic
948292239 2:236834418-236834440 TGGTAAGTGCATGCTGCTTGAGG - Intergenic
1170202027 20:13754617-13754639 TTTTCAGATAATGAAGCTTGTGG - Intronic
1170921097 20:20680151-20680173 TGGTAGGATAGTGTAGCCTGGGG - Intronic
1171309306 20:24133613-24133635 TGTTAAGAAAATGCAGTTGGTGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1174641301 20:52046758-52046780 TGTGAAGATAATCCAGCTTGGGG - Intergenic
1176037514 20:63047037-63047059 TGGGAAGAAAATGCAGGCTGTGG + Intergenic
1177032492 21:15999094-15999116 TGGTAAGAAAATGTTTCTTGAGG - Intergenic
1178704020 21:34858146-34858168 GGGAAAGTTGATGCAGCTTGGGG + Intronic
1179051802 21:37894703-37894725 AGGTAAGTTAATGCTGCATGAGG - Intronic
949694334 3:6676981-6677003 GGGTAGGAAAAAGCAGCTTGAGG - Intergenic
950938447 3:16867407-16867429 TGATAAAATAATGCAGCAAGAGG + Intronic
952044774 3:29305223-29305245 TGGTAAAACAATGGAGATTGGGG - Intronic
953947022 3:47158104-47158126 TGGCAATCTAATGAAGCTTGTGG + Intronic
956851611 3:73233162-73233184 TGGTAAAATAATGTAGCTGGTGG + Intergenic
957800642 3:85075425-85075447 TGGTAAAATAAGGCAGAATGTGG + Intronic
958423896 3:93959432-93959454 TGGCAAGAGAATGCAGCTTGTGG - Intronic
960900836 3:122552897-122552919 TGGTAAGGTAATACAGCAAGGGG - Intronic
962434954 3:135357645-135357667 TGGCAAGATAATTCATCTTAAGG - Intergenic
963087218 3:141449253-141449275 TGATAAAGTAATGCAGCTTTAGG + Exonic
966063919 3:175793613-175793635 TGGTTAGAAAATGCTGCTTTGGG - Intronic
967874304 3:194256313-194256335 TTGGAGGAAAATGCAGCTTGAGG - Intergenic
972689922 4:41386949-41386971 TGGTAAAACACTGCAGCTTTTGG + Intronic
973590482 4:52435987-52436009 TCGTAATATAAGGCAGCTTTGGG + Intergenic
974223232 4:59003406-59003428 AGGTAATATAAAGAAGCTTGAGG - Intergenic
974317995 4:60306813-60306835 TGGTAAGAAATTTCAGCCTGTGG - Intergenic
978543623 4:109846391-109846413 CGTTAGGATAATGCAGCTTCAGG - Intergenic
978908555 4:114038412-114038434 TGGTAAAATTATGAAGCTTATGG + Intergenic
980522445 4:133951179-133951201 TGATGAGATAAGGCTGCTTGTGG - Intergenic
982236824 4:153258970-153258992 TGGTATGAGAAAGCAGCTTTCGG + Intronic
983682784 4:170372780-170372802 TGGTAAGATATTGGATATTGAGG - Intergenic
983806641 4:172001743-172001765 TCGTAAGATAAAGCTGCTTCAGG + Intronic
986610002 5:9557706-9557728 TGGAAAGAGAATGGAGTTTGGGG - Intergenic
988117839 5:26919981-26920003 TGGGAAGAGAATCCTGCTTGAGG + Intronic
990303317 5:54470957-54470979 TTGTAAGAAAATACAGATTGTGG + Intergenic
993794859 5:92254512-92254534 TGGTATGAGACGGCAGCTTGTGG - Intergenic
994566672 5:101455561-101455583 TGGTCAGACAGTGCAACTTGTGG - Intergenic
995599515 5:113780344-113780366 TGGCAAATTAATGGAGCTTGAGG + Intergenic
999618118 5:153446763-153446785 TGGTAATATAAGGAAGCTTAAGG - Intergenic
1001212883 5:169827205-169827227 TGCTTAGATAATGCTTCTTGAGG + Intronic
1001858856 5:175035793-175035815 TGCTAAGATAATGTAAATTGCGG + Intergenic
1004511003 6:16284717-16284739 TTGTAAGAAAATGCAGCTAGTGG + Intronic
1007958223 6:45936115-45936137 TGGTATAAAAATGCAGTTTGAGG - Intronic
1008362826 6:50642131-50642153 TTGTAAAATAATACATCTTGGGG - Intergenic
1010896503 6:81371428-81371450 TGGTTAGACAATGAAGCTTGAGG + Intergenic
1011604045 6:89084961-89084983 TGGTAAGAAAATGTAGATTATGG - Exonic
1013057952 6:106603466-106603488 TGGTAAGAACATGCAGTATGAGG - Intronic
1017308000 6:152942079-152942101 AGGTAAAATAATACATCTTGTGG - Intergenic
1019611558 7:1939402-1939424 TGCTGAGATTCTGCAGCTTGTGG + Intronic
1020497449 7:8874050-8874072 TGGTAAGGGAATGCAGATTATGG + Intergenic
1021248077 7:18289422-18289444 TGGTAAGCTGAGGCAGGTTGAGG - Intronic
1023205902 7:37749528-37749550 TGGAAACAGAATGCAGCTTTGGG - Intronic
1023392693 7:39725213-39725235 TGGTAAAATAGTACAGCTTTTGG + Intergenic
1026626599 7:71998274-71998296 TGGGAAGAGAATCAAGCTTGGGG + Intronic
1027783011 7:82543077-82543099 TGGTAAAATCATGCATTTTGGGG - Intergenic
1031072994 7:117183056-117183078 TGGTAAGATAAGACATCTTCAGG + Intronic
1031303319 7:120091222-120091244 TGGTAAGAGAAAGCAGCTTGAGG - Intergenic
1032281501 7:130506439-130506461 TGGGACGATAGTGCAGCTTTGGG - Exonic
1045445561 8:102259638-102259660 TGGTAACATCATACAGCTAGAGG + Intronic
1046099640 8:109599929-109599951 TGGGAAAATAATCCAGCTAGAGG - Intronic
1050363257 9:4851272-4851294 TTGTAAGATGATGTATCTTGAGG + Intronic
1051801863 9:20943845-20943867 TGGTAAGATAATGCAGCTTGTGG - Intronic
1055271436 9:74563971-74563993 TGGCAAGAGAATGCAGCTGTAGG + Intronic
1055570730 9:77614452-77614474 TGGCAAAATTATGCAGCATGGGG - Intronic
1056618542 9:88190206-88190228 TGGAAAGATGGGGCAGCTTGGGG - Intergenic
1060362453 9:122972731-122972753 TGGAAACCTAATTCAGCTTGAGG + Intronic
1060730723 9:126035136-126035158 TGGCAAGATAAAGCTGCTTGTGG + Intergenic
1187803746 X:23095373-23095395 TGCTCAAATAATGTAGCTTGAGG - Intergenic
1194743517 X:97603963-97603985 TGGGAATCTAATGCAGATTGTGG - Exonic
1196009653 X:110873100-110873122 TTGTAAGATAATTAAGGTTGTGG + Intergenic
1196143094 X:112286925-112286947 TGGTAAGATAATTTAGGTTGGGG - Intergenic
1198962956 X:142202097-142202119 TCTTGAGATAAGGCAGCTTGGGG - Intergenic
1200100049 X:153685790-153685812 TGCTCAGAGAATGCAGTTTGGGG + Intronic