ID: 1051809154

View in Genome Browser
Species Human (GRCh38)
Location 9:21031019-21031041
Sequence AGCAGTTCCTGCCTTTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051809154_1051809164 29 Left 1051809154 9:21031019-21031041 CCCCTATAAAGGCAGGAACTGCT 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1051809164 9:21031071-21031093 CAGCTTGTATCAGAATTACCTGG No data
1051809154_1051809161 -5 Left 1051809154 9:21031019-21031041 CCCCTATAAAGGCAGGAACTGCT 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1051809161 9:21031037-21031059 CTGCTAAAGGGTTTGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051809154 Original CRISPR AGCAGTTCCTGCCTTTATAG GGG (reversed) Intronic
902259900 1:15217005-15217027 AGCATTTCTTATCTTTATAGTGG + Intronic
903708110 1:25301803-25301825 AGCTGTGCCTGCCTCTACAGTGG + Intronic
903719001 1:25390610-25390632 AGCTGTGCCTGCCTCTACAGTGG - Intronic
907157055 1:52344205-52344227 CACAGTTCCCGCCTCTATAGTGG + Intronic
909329095 1:74391208-74391230 AACAGATCCTGCCTTTATGGAGG + Intronic
911849486 1:102798961-102798983 AGAATTTTCTGCCTTTAAAGAGG - Intergenic
914217463 1:145645266-145645288 TTCAGTTCCTTCCTTAATAGTGG - Intronic
914470032 1:147967951-147967973 TTCAGTTCCTTCCTTAATAGTGG - Intronic
918420077 1:184355199-184355221 CGCAGTTCCTGCCTCTGCAGAGG - Intergenic
918440681 1:184563941-184563963 AGCATTTCTTGATTTTATAGAGG - Intronic
918635117 1:186765547-186765569 AGGAGTTCTTTCCTTTTTAGTGG - Intergenic
919651036 1:200148820-200148842 AGCATTTCCTGTCCTTATAAGGG + Intronic
920756965 1:208741678-208741700 AGCATTTCTTGCCTATATTGAGG + Intergenic
921847771 1:219902323-219902345 GGCATTTCCAGCCTTTACAGTGG + Intronic
921932058 1:220762720-220762742 AGCAGTTCCTGCCCATACACAGG - Intronic
1065047349 10:21756297-21756319 AGCAGTTCGTGTCTTTATTGGGG - Intergenic
1070243867 10:74711572-74711594 AGCAGTGGTTGCCTTTGTAGGGG + Intergenic
1070963290 10:80514302-80514324 AGGAGTTGCTGCATTTAAAGAGG + Intronic
1073513734 10:104059065-104059087 AGCAGTTCCTGACATTTTAGGGG - Intronic
1073589234 10:104740569-104740591 AGGAGTTCATGCCATTATGGAGG - Intronic
1075011554 10:118874705-118874727 AGCAGTATCTGCCTTGATTGAGG - Intergenic
1075905775 10:126080792-126080814 AGCTGTGACTGCCTTTATGGTGG - Intronic
1076173993 10:128351489-128351511 AGAAGGTCTTGCCTTAATAGTGG - Intergenic
1079961245 11:26926909-26926931 AGGAATTACTGCTTTTATAGAGG - Intergenic
1083900430 11:65640821-65640843 AGCAGTTCCTGCCCTGAAGGAGG - Exonic
1084647577 11:70467403-70467425 AGCAGCCTCTGCCTTTCTAGAGG - Intergenic
1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG + Intergenic
1087159394 11:94934362-94934384 TTCAGTTCCTGCCTTTCCAGTGG - Intergenic
1093163553 12:15778752-15778774 AGCTGTTCATGCCTTTATGGGGG + Intronic
1093576686 12:20739244-20739266 AGCAGTTTCTGCTTTCATGGAGG + Intronic
1094627665 12:32140010-32140032 AGTGGCTCCTGCCTTTGTAGTGG + Intronic
1095219758 12:39596288-39596310 AGCATTTCTTGCCTTTCTTGAGG + Intronic
1102064603 12:109963474-109963496 AGTAGTTCCTGTTTTCATAGAGG - Intronic
1103900549 12:124301599-124301621 AGCAAATCCGGCCTTTATAAGGG + Intronic
1107075357 13:36317346-36317368 AGCAAGTCCTGCTTTTCTAGAGG + Intronic
1109726054 13:66343352-66343374 AGCAGTGCATTCCTTTCTAGAGG + Intronic
1112507618 13:99984658-99984680 AGCCCTGCCTGCCTTTCTAGAGG - Intronic
1114594556 14:23900017-23900039 AACAGATCCTGCCTTTTGAGTGG - Intergenic
1115525554 14:34277005-34277027 AGCAGTTCCTCCTTTTGTATTGG - Intronic
1122710846 14:103656548-103656570 AGCGGTTTCTGCTTTCATAGAGG + Intronic
1125714142 15:41809769-41809791 ATCAGGTCCTGCCTTTCCAGAGG - Intronic
1128999233 15:72319339-72319361 AGCAGTCCCTGCCTTTCAATTGG - Intronic
1129315416 15:74740155-74740177 GGCAGTTCCTGCCTTCAGGGAGG - Intergenic
1134012680 16:10866877-10866899 ATCAGCTCCTGCCTTCAAAGGGG + Intergenic
1134270593 16:12729760-12729782 AGAGTTTCCTGCCTTTACAGTGG - Intronic
1138192943 16:55031532-55031554 TGCAGTCCCTGCCTTGTTAGAGG + Intergenic
1140536297 16:75713098-75713120 AAAAGCTCCTGCCTTTATACTGG + Intronic
1143682994 17:8491515-8491537 ATGAGATCCTGCCTTTTTAGAGG + Intronic
1149539229 17:57456187-57456209 AGCAGTTCCTGCCTTTGGCAGGG + Intronic
1149680483 17:58503689-58503711 AACAGTTACTGCCTTCCTAGTGG + Intronic
1150863577 17:68826029-68826051 AGAAAGTGCTGCCTTTATAGTGG - Intergenic
1151924790 17:77187273-77187295 TGCAGTACCTTCCTTTATAATGG + Intronic
1158180957 18:54714390-54714412 AGCAGTTCCTGACCTGATGGGGG + Intergenic
1158339837 18:56454061-56454083 AGAAATTCCTGTCTTTATAAGGG - Intergenic
1159879223 18:73842700-73842722 AGCAGTTCCTGCTTTTCTAAGGG - Intergenic
1160589445 18:79934919-79934941 TGCAGTTCCTGCCTTGTGAGTGG - Intronic
1161559766 19:4966213-4966235 AGCATTTCCTTCCTTTTTGGAGG + Intergenic
1164121916 19:22273272-22273294 AGCAGTTCCTGTCCTTTTAAGGG + Intergenic
1164464067 19:28472645-28472667 AGCAGTCCCTGCATTTTAAGAGG - Intergenic
1166104370 19:40590147-40590169 TGCAGTTCCTGCCTCTCCAGGGG - Intronic
1166972976 19:46582773-46582795 ATCAGTGCCTGCCCCTATAGGGG + Intronic
1168682357 19:58325274-58325296 AGCATGGCCTGCCTTTATGGAGG - Intergenic
926327062 2:11794324-11794346 AACTGTTCCTTACTTTATAGCGG - Intronic
930542559 2:52725055-52725077 AGAAATTACTGCCTTTTTAGGGG + Intergenic
932295650 2:70621594-70621616 AGCAAGTCCTGCTTTTCTAGGGG + Intronic
932512719 2:72311375-72311397 ATCATTCCCAGCCTTTATAGAGG + Intronic
933261127 2:80132663-80132685 ATCAATGCCTGCATTTATAGGGG - Intronic
933781622 2:85806514-85806536 AGCAAGTCCTTTCTTTATAGTGG + Intergenic
934542592 2:95188440-95188462 AGCAGTGCCTTACTTTCTAGGGG - Intergenic
935577108 2:104722575-104722597 AGTGGTTCCTGCCTTGATTGAGG + Intergenic
935631370 2:105214890-105214912 TGCATTTCCTGGCTTTCTAGTGG + Intergenic
942516460 2:176758378-176758400 AGCAATTCCTGCCTTTCTTGTGG - Intergenic
946471927 2:219968661-219968683 TGCAGTTCCTGCCACTAAAGAGG + Intergenic
946818760 2:223608855-223608877 ATCTCTTCCTGGCTTTATAGAGG + Intergenic
1173008730 20:39161276-39161298 AGCTTTTTCTGCCTTTATTGAGG + Intergenic
1180993997 22:19955493-19955515 AGCAGTTCCAGCCTTTGCTGGGG + Intronic
1183590257 22:38775783-38775805 GGCAGTTGCAGCATTTATAGTGG - Intronic
1183665780 22:39244991-39245013 AGCTGTTCCGGCCTTTATAAAGG + Intergenic
1184393531 22:44219326-44219348 CGCAGTTGCTGCCTTGCTAGAGG - Intronic
952180221 3:30909276-30909298 AGCAGCTGCTCCCTTTATATAGG + Intergenic
953176970 3:40561870-40561892 AGCAAGTCCTGCTTTTCTAGGGG + Intronic
953260913 3:41338358-41338380 AGCAGTCCCAGGCTTTATACAGG + Intronic
953481452 3:43255915-43255937 AGCAGCTCCTGCCTTTGTGTGGG + Intergenic
953680137 3:45033027-45033049 AGCTTTTCCAGCCTCTATAGTGG + Intronic
958804170 3:98789576-98789598 AGCAGTACATGTGTTTATAGGGG + Intronic
959650502 3:108746151-108746173 AGCAGCTCCTGGGTTCATAGGGG + Intronic
960719703 3:120613610-120613632 AGCATTTGCTGCCTTTATCTTGG - Intergenic
960898127 3:122527460-122527482 AGCAGATTCAGCCTTTATAAAGG + Intergenic
961742103 3:129039492-129039514 AGCAGTCCCTGCCCTCATGGAGG + Intronic
963521426 3:146363071-146363093 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
964257805 3:154797119-154797141 AGCAGTTTCTGCCTCCATGGAGG + Intergenic
964564249 3:158032377-158032399 AGAAGTTCCAGCCTTGACAGAGG - Intergenic
966066597 3:175828509-175828531 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
967212368 3:187180223-187180245 AGCAAGTCCCGCCTTTCTAGGGG - Intronic
970087368 4:12364780-12364802 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
972027075 4:34394974-34394996 AGAATTTTCTTCCTTTATAGGGG - Intergenic
972564130 4:40254864-40254886 AGCAGTGACTGCCTTCATTGGGG + Intergenic
973256500 4:48118603-48118625 AGCAGCTCCTGACTTTCTACTGG - Intronic
974080332 4:57205866-57205888 AGCAATTCCTGCCCTTGAAGAGG - Intergenic
974356632 4:60820895-60820917 AGCAGTGCTTGCCTTTAAAAAGG + Intergenic
975934106 4:79558733-79558755 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
976624583 4:87166425-87166447 AGTAATACCTTCCTTTATAGAGG - Intronic
977041854 4:92027005-92027027 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
977696862 4:99975437-99975459 AGCATTTTCTGCATCTATAGAGG - Intergenic
980755054 4:137147762-137147784 TGCAGTGGCTGCCTTTCTAGAGG - Intergenic
983337843 4:166419388-166419410 AAGAGTTACTGCCTTTAAAGAGG - Intergenic
984107056 4:175561118-175561140 AGCAGTTTCTTCTTGTATAGTGG - Intergenic
984444605 4:179819360-179819382 AGCACTTCCAGCATTAATAGTGG + Intergenic
988479094 5:31614491-31614513 AGAAGTTCCTCCATTTACAGTGG + Intergenic
988918943 5:35922983-35923005 ACCAGTTCCTGCTTCCATAGGGG - Intronic
989000234 5:36752218-36752240 AGCAGTGACAGCATTTATAGTGG + Intergenic
991148600 5:63337858-63337880 TGCAGATCCTTCTTTTATAGAGG + Intergenic
992317209 5:75568409-75568431 AGCCTTTCTTGCCTTGATAGTGG + Intronic
994706662 5:103215255-103215277 ACCACTTCATGCCATTATAGTGG - Intergenic
996080859 5:119256315-119256337 ACCAGTACCTGCTTTTGTAGAGG - Intergenic
1002409500 5:179062391-179062413 AGCAGTCTCTGTCTTCATAGAGG + Intronic
1002571862 5:180144145-180144167 AGCAGTTGCTGCCTGTGTTGTGG - Intronic
1003608136 6:7584147-7584169 AGCAGCTACTGGCTTTATAGTGG + Exonic
1004656455 6:17666773-17666795 AGAAGCTTCTGGCTTTATAGTGG - Intronic
1004978359 6:20993865-20993887 TGCAGTTCCTGCCTGTAAAATGG + Intronic
1005654861 6:27925170-27925192 AGCCGTACATGCCTTGATAGAGG + Intergenic
1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG + Intergenic
1008953734 6:57191042-57191064 AGCATTTCCTTCCTTTTTAAGGG + Intronic
1011919806 6:92559343-92559365 AGCATTTCCAGCATTAATAGTGG - Intergenic
1012635563 6:101535213-101535235 AACACATCATGCCTTTATAGAGG - Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1015142546 6:129951565-129951587 AGCAGTCCCTGCTTATTTAGGGG + Intergenic
1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG + Intronic
1020663614 7:11011742-11011764 GGCAGTGCCTTCCTTTTTAGAGG + Intronic
1021013798 7:15506690-15506712 AGCAGTTTCTGCATCTACAGTGG - Intronic
1021175601 7:17446262-17446284 AGCCGTTTCTGCATTTATTGAGG + Intergenic
1021399239 7:20190619-20190641 AGCAGTTCATGGCTTTAAAATGG + Intronic
1024125526 7:46290867-46290889 ACCAGTTCCTTCCTCTTTAGAGG - Intergenic
1024544794 7:50508222-50508244 AGCAGGTGCTGGCTTTAAAGTGG - Intronic
1030106810 7:105994466-105994488 AGCAGAGCCTGCCTTGACAGGGG + Intronic
1030109766 7:106017256-106017278 AGCAATTTATGCCTTTATATAGG - Intronic
1030274325 7:107703361-107703383 ATCATTTCCTCCCCTTATAGAGG - Intronic
1031140971 7:117943329-117943351 TTCTGTTCCTGCCTTTTTAGGGG - Intergenic
1032430903 7:131860631-131860653 AGCAGTTTCTGCCTCTCTAAGGG + Intergenic
1038164678 8:25074003-25074025 ACCAGTTCCTGCCTTGAAAATGG + Intergenic
1038846977 8:31239045-31239067 AGCACTTCCTGCCTCTACACTGG - Intergenic
1042452654 8:68966738-68966760 AGCAGTTGCATCCTTTATATTGG - Intergenic
1045013084 8:97975616-97975638 AGCAGCTCCTCTCTTTGTAGGGG + Intronic
1047113440 8:121816163-121816185 GGCAGTTCCTGCCTTAACTGAGG - Intergenic
1051809154 9:21031019-21031041 AGCAGTTCCTGCCTTTATAGGGG - Intronic
1052959117 9:34279525-34279547 AGAACTTCCTGCCTTTACAGAGG - Intronic
1057935595 9:99236149-99236171 AGCAGTGCCTCTTTTTATAGAGG + Intergenic
1058612215 9:106789260-106789282 AGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1058804436 9:108577380-108577402 AGAAGTTCTTGCCTTAATGGTGG - Intergenic
1061952335 9:133943505-133943527 AGCAGTGGCTGCCTTTGTGGGGG - Intronic
1185858756 X:3559005-3559027 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1185959307 X:4530204-4530226 TGCAGTTAATGCTTTTATAGGGG + Intergenic
1187856528 X:23641920-23641942 AGCATTTCCTTCCTTTTTTGAGG - Intergenic
1188153486 X:26710386-26710408 GGCAATTCCTGCCTTTATGCAGG - Intergenic
1189356210 X:40311728-40311750 GGCATTTCCTACCTTTATATTGG - Intergenic
1193096265 X:77552672-77552694 TGCAGTTCTTGCCTTTAAAGAGG + Intronic
1196072855 X:111544826-111544848 AGCAAGTCCTGCTTTTCTAGAGG + Intergenic
1197206350 X:123794055-123794077 AGCAGCTTCTGCCTCTGTAGAGG - Intergenic
1197352253 X:125393524-125393546 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic
1198192070 X:134316817-134316839 ACCTGTTCCTGCCTTTATACAGG - Intergenic
1198598190 X:138259513-138259535 AGCAAGTCCTGCTTTTCTAGGGG + Intergenic
1202076752 Y:21044145-21044167 AGCAAGTCCTGCTTTTCTAGGGG - Intergenic