ID: 1051810996

View in Genome Browser
Species Human (GRCh38)
Location 9:21049319-21049341
Sequence CTGCTGAAAGAGAAAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051810996_1051810998 1 Left 1051810996 9:21049319-21049341 CCATCTGCTTTCTCTTTCAGCAG No data
Right 1051810998 9:21049343-21049365 AGAGCTCACTGAAGCATTGAGGG No data
1051810996_1051810997 0 Left 1051810996 9:21049319-21049341 CCATCTGCTTTCTCTTTCAGCAG No data
Right 1051810997 9:21049342-21049364 AAGAGCTCACTGAAGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051810996 Original CRISPR CTGCTGAAAGAGAAAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr