ID: 1051812913

View in Genome Browser
Species Human (GRCh38)
Location 9:21070509-21070531
Sequence ACTCCTGGTTTTGCTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051812913_1051812915 -1 Left 1051812913 9:21070509-21070531 CCACTTGGAGCAAAACCAGGAGT No data
Right 1051812915 9:21070531-21070553 TTGTGCTGTGCATGAGCTGCCGG No data
1051812913_1051812916 0 Left 1051812913 9:21070509-21070531 CCACTTGGAGCAAAACCAGGAGT No data
Right 1051812916 9:21070532-21070554 TGTGCTGTGCATGAGCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051812913 Original CRISPR ACTCCTGGTTTTGCTCCAAG TGG (reversed) Intergenic
No off target data available for this crispr