ID: 1051813217

View in Genome Browser
Species Human (GRCh38)
Location 9:21074522-21074544
Sequence GGAATCCACAAAGCTGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051813217_1051813227 4 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG No data
1051813217_1051813220 -8 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813220 9:21074537-21074559 TGGATTCCTAAGGTGTGATATGG No data
1051813217_1051813222 -3 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813222 9:21074542-21074564 TCCTAAGGTGTGATATGGGAAGG No data
1051813217_1051813226 0 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813226 9:21074545-21074567 TAAGGTGTGATATGGGAAGGGGG No data
1051813217_1051813221 -7 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813221 9:21074538-21074560 GGATTCCTAAGGTGTGATATGGG No data
1051813217_1051813228 7 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813228 9:21074552-21074574 TGATATGGGAAGGGGGAAGGTGG No data
1051813217_1051813225 -1 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813225 9:21074544-21074566 CTAAGGTGTGATATGGGAAGGGG No data
1051813217_1051813224 -2 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813224 9:21074543-21074565 CCTAAGGTGTGATATGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051813217 Original CRISPR GGAATCCACAAAGCTGGATT AGG (reversed) Intergenic
No off target data available for this crispr