ID: 1051813227

View in Genome Browser
Species Human (GRCh38)
Location 9:21074549-21074571
Sequence GTGTGATATGGGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051813215_1051813227 10 Left 1051813215 9:21074516-21074538 CCATCTCCTAATCCAGCTTTGTG No data
Right 1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG No data
1051813219_1051813227 -2 Left 1051813219 9:21074528-21074550 CCAGCTTTGTGGATTCCTAAGGT No data
Right 1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG No data
1051813217_1051813227 4 Left 1051813217 9:21074522-21074544 CCTAATCCAGCTTTGTGGATTCC No data
Right 1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051813227 Original CRISPR GTGTGATATGGGAAGGGGGA AGG Intergenic
No off target data available for this crispr