ID: 1051815908

View in Genome Browser
Species Human (GRCh38)
Location 9:21105322-21105344
Sequence CTGGTTTTCCACATATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051815908_1051815912 -1 Left 1051815908 9:21105322-21105344 CCACTATATATGTGGAAAACCAG No data
Right 1051815912 9:21105344-21105366 GTGAGGTGAGAGGATACTTCAGG No data
1051815908_1051815913 17 Left 1051815908 9:21105322-21105344 CCACTATATATGTGGAAAACCAG No data
Right 1051815913 9:21105362-21105384 TCAGGAAAGCTAGATAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051815908 Original CRISPR CTGGTTTTCCACATATATAG TGG (reversed) Intergenic
No off target data available for this crispr