ID: 1051816681

View in Genome Browser
Species Human (GRCh38)
Location 9:21116510-21116532
Sequence GTGCATAAACTAGAAAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051816681_1051816684 24 Left 1051816681 9:21116510-21116532 CCTATGTTTTCTAGTTTATGCAC No data
Right 1051816684 9:21116557-21116579 AATAATCTTTTGTATTTCTGTGG 0: 123
1: 575
2: 1010
3: 1410
4: 3014

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051816681 Original CRISPR GTGCATAAACTAGAAAACAT AGG (reversed) Intergenic
No off target data available for this crispr