ID: 1051820262

View in Genome Browser
Species Human (GRCh38)
Location 9:21157538-21157560
Sequence GAGTCTTATTTTTGTTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051820262_1051820265 30 Left 1051820262 9:21157538-21157560 CCAAGCAAACAAAAATAAGACTC No data
Right 1051820265 9:21157591-21157613 ACACAGGTTACAATTAAAGATGG No data
1051820262_1051820264 14 Left 1051820262 9:21157538-21157560 CCAAGCAAACAAAAATAAGACTC No data
Right 1051820264 9:21157575-21157597 AACTTTATATATAAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051820262 Original CRISPR GAGTCTTATTTTTGTTTGCT TGG (reversed) Intergenic
No off target data available for this crispr