ID: 1051820988

View in Genome Browser
Species Human (GRCh38)
Location 9:21168069-21168091
Sequence ACTCAGTATCTATAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051820988_1051820994 27 Left 1051820988 9:21168069-21168091 CCTCTGCCCTATAGATACTGAGT No data
Right 1051820994 9:21168119-21168141 CAAATCAGCTATTTAGTAAGTGG No data
1051820988_1051820992 -6 Left 1051820988 9:21168069-21168091 CCTCTGCCCTATAGATACTGAGT No data
Right 1051820992 9:21168086-21168108 CTGAGTCCTTAAATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051820988 Original CRISPR ACTCAGTATCTATAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr