ID: 1051820992

View in Genome Browser
Species Human (GRCh38)
Location 9:21168086-21168108
Sequence CTGAGTCCTTAAATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051820988_1051820992 -6 Left 1051820988 9:21168069-21168091 CCTCTGCCCTATAGATACTGAGT No data
Right 1051820992 9:21168086-21168108 CTGAGTCCTTAAATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051820992 Original CRISPR CTGAGTCCTTAAATGGAATG AGG Intergenic
No off target data available for this crispr