ID: 1051822270

View in Genome Browser
Species Human (GRCh38)
Location 9:21181712-21181734
Sequence TTGACCAATGGGAGACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 2, 1: 2, 2: 2, 3: 17, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822270_1051822282 20 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822282 9:21181755-21181777 CAGGCAGGGAACCCCTGTCTTGG No data
1051822270_1051822283 21 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822270_1051822277 5 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822277 9:21181740-21181762 CACCCGTCACATCACCAGGCAGG No data
1051822270_1051822278 6 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822278 9:21181741-21181763 ACCCGTCACATCACCAGGCAGGG No data
1051822270_1051822274 1 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822270 Original CRISPR TTGACCAATGGGAGACAGAC TGG (reversed) Intergenic
901594829 1:10376527-10376549 TTGACCTATGGGGGACAAACGGG - Exonic
902811772 1:18892127-18892149 TTGCCCTATGGGAGACAGACTGG + Intronic
905342766 1:37290631-37290653 TGGAGGAAGGGGAGACAGACTGG - Intergenic
905778232 1:40684788-40684810 CTGATCAATGGGAGACAGGAAGG - Intergenic
906256623 1:44355338-44355360 TTGACCAATGGGCTGCAGTCAGG + Intergenic
907242150 1:53086716-53086738 TTCACCACGGGGAGCCAGACTGG + Intergenic
909351723 1:74661254-74661276 TTGACAAATGGTAGAAAGACTGG - Intronic
910044021 1:82890057-82890079 TTGAGCAATGGGAGAGAAATGGG + Intergenic
911081425 1:93935734-93935756 TTGACCCATGGGATGCAGAATGG - Intergenic
911613983 1:99988698-99988720 GAGACCAAGGGGAGAAAGACAGG - Intronic
912859569 1:113201382-113201404 TTGATCAATGGGCTACAGAATGG - Intergenic
913310890 1:117491578-117491600 TTGACCCATGGGCTACAGAATGG - Intronic
913400237 1:118423573-118423595 CTGACTAATTGGAGACAGTCTGG + Intergenic
916568886 1:166008095-166008117 GGGACCCATGGGAGACGGACTGG + Intergenic
916663045 1:166939917-166939939 TTGAACATTTGGATACAGACGGG - Intronic
919578029 1:199336659-199336681 GGGACCCATGGGAGTCAGACTGG - Intergenic
920758083 1:208754550-208754572 TTGACCAGTGTGACACAGATGGG + Intergenic
921012942 1:211161147-211161169 GAGACCAGTGGGAGACAGACTGG + Intergenic
921416651 1:214896390-214896412 ATGACCACTGGGAAAGAGACAGG - Intergenic
922389465 1:225124908-225124930 TTGACCCATGGGCTACAGAATGG + Intronic
923351252 1:233108935-233108957 TATACCAATGGGAGAGGGACAGG + Intronic
924543724 1:245005859-245005881 GTGACGAATGGGAGATAGCCAGG + Intronic
1067525961 10:47038761-47038783 TTGAACAATGGAAAATAGACAGG - Intergenic
1069671917 10:70213512-70213534 TTGACGAAGGGGAAACCGACTGG - Exonic
1070020005 10:72575774-72575796 TTGAGGAAAGGGAGAGAGACGGG - Intronic
1070870605 10:79748403-79748425 GGGAACCATGGGAGACAGACTGG - Intergenic
1074104878 10:110381827-110381849 TTGACCAGTGGGACACTGGCTGG + Intergenic
1078294848 11:10057438-10057460 GGGACCCATGGGAGAAAGACTGG - Intronic
1078401757 11:11034623-11034645 TTTAGAATTGGGAGACAGACTGG + Intergenic
1084122277 11:67076660-67076682 ATGACCATGGGGAGACAGACAGG - Intergenic
1085718483 11:78893261-78893283 TGGCCCAATGGGAGGCATACAGG + Intronic
1086484317 11:87282180-87282202 TTGACCAATGGTACACACTCAGG + Intronic
1087132530 11:94680651-94680673 TTGATGAATGTGAGACAGAGAGG - Intergenic
1089328697 11:117675072-117675094 TTTACAAATGGGAAACAGAATGG - Intronic
1094280490 12:28732155-28732177 CTGCCAAATGGGAGACAGATGGG + Intergenic
1095824290 12:46515795-46515817 GGGACCCGTGGGAGACAGACTGG + Intergenic
1096213421 12:49784365-49784387 TGGACCAAGCGGAGACAGTCAGG - Intergenic
1097291462 12:57919677-57919699 TCGACAAATAGGAGACATACTGG + Intergenic
1097405572 12:59185359-59185381 TTGACCAATGAGAGACAAGAAGG - Intergenic
1098389274 12:69951987-69952009 TTGAAGGATGGGAGACAGAAAGG + Intronic
1102800955 12:115733361-115733383 TTGACCAAAGTTACACAGACAGG + Intergenic
1105814592 13:24023129-24023151 TTGAACAATGAGACACAGGCTGG - Intronic
1111626126 13:90790064-90790086 TTGACCAATGAGAGAAAAAGAGG - Intergenic
1113934225 13:113984917-113984939 TGGACCAATGGGTGACTGATGGG - Intronic
1113934907 13:113988852-113988874 TGGACCAATGGGTGACTGATGGG - Intronic
1114951623 14:27761637-27761659 AGGACCCATGGGAGACAGACTGG + Intergenic
1116028207 14:39538629-39538651 AGGACCCATGGGACACAGACTGG - Intergenic
1117003924 14:51399081-51399103 ATGAGCAATGGTAGACACACAGG - Intergenic
1117967644 14:61221847-61221869 TTGCCCAATGGGAGAAGGAAGGG + Intronic
1117970562 14:61246951-61246973 ATAACCATTGGGAGACAGGCAGG - Intronic
1118688406 14:68314323-68314345 TTGACCACTGAGAGACATTCGGG - Intronic
1120240954 14:81948931-81948953 TTGCCCTATTGGAGACACACAGG + Intergenic
1122170811 14:99873268-99873290 GTGACAAATGTGAGATAGACTGG + Intronic
1122306210 14:100768389-100768411 CAGACCCATGGGAGACAGCCTGG - Intergenic
1124895821 15:33776537-33776559 TTGGTCAAAGGGAGCCAGACAGG - Intronic
1129584559 15:76849388-76849410 GGGACCCATGGGAGACAGACTGG - Intronic
1131221087 15:90584621-90584643 TTGACAAATGTGCGACAGATTGG - Intronic
1133842863 16:9425774-9425796 TTGACCATTGTGAGACAGCCTGG - Intergenic
1135223536 16:20635996-20636018 TTGACCAAAGGGGAACATACAGG - Intronic
1135930004 16:26728216-26728238 TTGGCCAGTGAGAGACAGCCTGG + Intergenic
1137909927 16:52367241-52367263 TTGAACAATGGAAGACAGACTGG - Intergenic
1139765680 16:69227658-69227680 TTGACCAATGGGACACTGAAGGG - Intronic
1143631413 17:8142474-8142496 CAGACCAATGGGAGTCAGGCCGG + Intronic
1143717095 17:8781647-8781669 TTAACAAATGAGTGACAGACTGG + Intergenic
1143904754 17:10199179-10199201 CTGAACAATGGGTGAAAGACAGG + Intergenic
1146714439 17:35072652-35072674 ATAACCAATGGGAGAAAAACGGG + Intronic
1153834766 18:8954110-8954132 TTGCCCAGAGGAAGACAGACTGG + Intergenic
1156800657 18:41109363-41109385 GAGACCCATGAGAGACAGACTGG - Intergenic
1160186189 18:76678495-76678517 GCGACCAATGGCAGATAGACTGG + Intergenic
1161614859 19:5264427-5264449 CCAAGCAATGGGAGACAGACAGG - Intronic
1164948204 19:32313847-32313869 TTGACCTCTGGGAAGCAGACTGG - Intergenic
1167915201 19:52734783-52734805 TTGACCTATAGCAGAAAGACCGG + Intronic
1168100124 19:54137212-54137234 GTACCTAATGGGAGACAGACAGG - Intergenic
928832872 2:35509819-35509841 TGGACCAATGTCAAACAGACAGG + Intergenic
930304800 2:49665109-49665131 GGGACCCATGGGAGGCAGACTGG + Intergenic
933242293 2:79935564-79935586 TTGAACAAGGTGAGCCAGACTGG - Intronic
934485729 2:94708062-94708084 AGGATCCATGGGAGACAGACTGG - Intergenic
935107254 2:100056298-100056320 GTGAGTAATGGGAGACAGAAAGG - Intronic
935460816 2:103331423-103331445 TTGACCAATGTGATACTTACTGG + Intergenic
938311429 2:130291343-130291365 TTGACCCATGGGCTACAGAATGG + Intergenic
939477043 2:142700468-142700490 TTTACCACTGGGAGACAGGGAGG - Intergenic
940515677 2:154681433-154681455 TTGACTAATCCGTGACAGACAGG + Intergenic
943675354 2:190711431-190711453 TTGGCCAAGTGGAGACTGACAGG - Intergenic
1173345035 20:42191499-42191521 TGGACCAAATGGAGACAGAAGGG + Intronic
1174766312 20:53256990-53257012 TTGAGCAATGGAAGAAAGATTGG + Intronic
1176242630 20:64082208-64082230 TTGAGCAGGGGCAGACAGACAGG - Intronic
1178519302 21:33274522-33274544 TTGACCCATGGGCTACAGAATGG + Intronic
1179347686 21:40576158-40576180 TTGACTAATAGGAGAAAGGCTGG - Intronic
1181931040 22:26401891-26401913 CTGGCCAATGGGAAACCGACTGG + Intergenic
1184414266 22:44343067-44343089 TTGTCCAAGGGGGCACAGACAGG - Intergenic
1184785074 22:46667734-46667756 TTAACGAATGGGAGACAAGCAGG + Intronic
951313142 3:21154952-21154974 TTGACCCATGGGCTACAGAATGG + Intergenic
951950056 3:28190180-28190202 ATGACCAATGAGAGACATGCAGG + Intergenic
952974967 3:38686038-38686060 CTGTCCAGTGGGATACAGACTGG + Intergenic
955216402 3:56987963-56987985 TCCACAAATGGGTGACAGACAGG + Intronic
963053047 3:141158624-141158646 GGAACCCATGGGAGACAGACTGG - Intergenic
963243104 3:143030587-143030609 TTGATCAATGGGATAGAGAATGG - Intronic
964255636 3:154772044-154772066 GGGACCCATGGGAGACAGACTGG + Intergenic
965233871 3:166090521-166090543 TTTTGCAATGTGAGACAGACAGG - Intergenic
965975715 3:174619132-174619154 TTTACTAATAGGAGACAGATGGG + Intronic
966654070 3:182333341-182333363 TTGACCAAAGGCAGATAGAGTGG + Intergenic
967398863 3:189038676-189038698 GTAACAGATGGGAGACAGACTGG + Intronic
967651053 3:191987622-191987644 TTGAGGCATTGGAGACAGACAGG - Intergenic
969238641 4:5885640-5885662 TTGTCCTAGGGGAGACAGAGGGG - Intronic
970580504 4:17470562-17470584 TTGACCACTGGGAGACGGGCTGG - Intronic
971331048 4:25681625-25681647 TTGCCCCTGGGGAGACAGACAGG - Intergenic
971977792 4:33712861-33712883 TTGATCAATGGTATACAGAGTGG + Intergenic
972345037 4:38185606-38185628 GTGTCCAGTGGGAGACACACAGG + Intergenic
973574322 4:52271064-52271086 TTGACAAATGGCAGACACACAGG - Intergenic
973793974 4:54404853-54404875 TTAACAGATGGGTGACAGACTGG + Intergenic
977002157 4:91518359-91518381 GGGACCCATGGGAGACAGATTGG + Intronic
977729338 4:100332148-100332170 GGGACCCATGGGAGACAGATTGG - Intergenic
978286875 4:107089354-107089376 CTGACTAAAGGGAGAAAGACAGG - Intronic
978488796 4:109287889-109287911 CAGACCAATGGGAGACATATGGG + Intronic
980533731 4:134088115-134088137 TATAACAATGGGAGACAGAAGGG - Intergenic
981510271 4:145548902-145548924 ATCACCAATGAGAGACAGATGGG + Intronic
987098886 5:14574994-14575016 AGGACCAATGGGAGCCAGCCAGG + Intergenic
987145664 5:14988973-14988995 TTCACCAATGTTAGCCAGACTGG - Intergenic
987401358 5:17480407-17480429 TTGACCAAGAGGAGACAGGCCGG + Intergenic
988532087 5:32036872-32036894 TTGACCACTGGGAGACCACCTGG + Intronic
990500337 5:56390135-56390157 GGGACCTATGGGAGACAAACTGG - Intergenic
993056916 5:82991714-82991736 GTGACCAATGGGAAACACAGGGG + Intergenic
993351242 5:86853116-86853138 GGGACCCATGGGAGACAGTCTGG + Intergenic
994157610 5:96521369-96521391 TGGAGCAATGGGAGAAGGACTGG - Intergenic
997135058 5:131316546-131316568 TTGTCCAATGAGAGACAAAAGGG + Intronic
997597413 5:135116320-135116342 TTCCCCAATGGGAGATACACAGG - Intronic
998572915 5:143280700-143280722 TTAACCAATTGGTGACAGATGGG + Intronic
999074538 5:148781660-148781682 TTGACCTGTGGGAGATGGACTGG - Intergenic
1000987211 5:167874234-167874256 TAGTCTAGTGGGAGACAGACAGG - Intronic
1001607879 5:172975950-172975972 TTGACGAAGGGGAAACCGACTGG + Intergenic
1002859803 6:1070678-1070700 TTGATCCATGGGAGAGAGACAGG - Intergenic
1009812161 6:68681949-68681971 AAGAGCAATGTGAGACAGACAGG + Intronic
1010019255 6:71140045-71140067 GAGACCCATGAGAGACAGACTGG - Intergenic
1010554709 6:77265029-77265051 TCTACCAATGGGAGACAATCTGG - Intergenic
1010684111 6:78831767-78831789 TTGAACAATGGCAAACAGTCTGG - Intergenic
1014177718 6:118348715-118348737 ATGACCAAGGGGACACAGAGCGG + Intergenic
1017308718 6:152951943-152951965 TTTACCTATTGGAGACAGATAGG - Intergenic
1022279833 7:28896306-28896328 TTGATCCATGGGAGGCAGAATGG + Intergenic
1023241289 7:38150884-38150906 GGGACCCATGGGAGACAGGCTGG - Intergenic
1023549048 7:41349478-41349500 TTGACCAGTGGGCCACAGATAGG + Intergenic
1023886355 7:44360020-44360042 GGAACCCATGGGAGACAGACTGG + Intergenic
1027142243 7:75666700-75666722 TTGTCCAATGGGAGAAAGTACGG + Intronic
1027193779 7:76013919-76013941 TAGACCAATGGCAGATACACAGG - Intronic
1030234379 7:107242681-107242703 GGGACCTGTGGGAGACAGACTGG - Intronic
1030580952 7:111354422-111354444 TTGACCAACTGGAAATAGACAGG + Intronic
1030809383 7:113956099-113956121 AGGACCCATGGGAGACAGGCTGG + Intronic
1030886706 7:114947489-114947511 TTGACCAATGAGATAAATACAGG - Intronic
1030973097 7:116086294-116086316 TTGACTAACTGGAAACAGACAGG - Intronic
1031183611 7:118447675-118447697 TTGATCCATGGGATACAGAATGG + Intergenic
1032515895 7:132505983-132506005 TTGACAAATCAGAGCCAGACTGG - Intronic
1034275721 7:149823024-149823046 TTGGCAGATGGGAGACAGAGGGG - Intergenic
1035556363 8:569994-570016 TGGACCAATGGCTGATAGACAGG + Intergenic
1035941765 8:3909349-3909371 CTGACGAATGTGAGTCAGACTGG - Intronic
1036421630 8:8601251-8601273 TGGAACAATAGGAGACAGATAGG - Intergenic
1037299640 8:17437847-17437869 CTGTCCAAAGAGAGACAGACAGG + Intergenic
1039826106 8:41175421-41175443 GTCACCAATGGGAGATAGAATGG - Intergenic
1039902937 8:41766448-41766470 TTTGCCAATGGTAGTCAGACTGG - Intronic
1041561832 8:59226715-59226737 GGGACCCGTGGGAGACAGACTGG - Intergenic
1042975269 8:74461771-74461793 TTGACCCATGGGGGTCAAACAGG - Intronic
1043227405 8:77749069-77749091 GGGACCCATGGGAAACAGACTGG - Intergenic
1044162482 8:88936273-88936295 AGGACCCATGGGAGACAGAAGGG - Intergenic
1046098393 8:109586627-109586649 TTAACCAATGAGAGGCAGTCAGG + Intronic
1046324500 8:112622900-112622922 TTTACAAATGGGAGTCAGAGGGG + Intronic
1046359019 8:113126332-113126354 ATGTCCAAGGGGAGACAAACTGG + Intronic
1046436222 8:114192901-114192923 TTGAACAATTGGACACAGAGTGG + Intergenic
1048462279 8:134631211-134631233 TTCAGCAATGGCAGACAGACAGG - Intronic
1050383699 9:5060908-5060930 TTGACCCATGGGCTACAGAATGG + Intronic
1051822270 9:21181712-21181734 TTGACCAATGGGAGACAGACTGG - Intergenic
1051823502 9:21193770-21193792 TTGACCAATGGCAGACAGACTGG - Intergenic
1051825323 9:21212308-21212330 TTGACCAATGGGAGACAGACTGG - Intronic
1051827302 9:21234368-21234390 TTGACCAATGGCAGACAGACTGG - Intronic
1051984584 9:23068439-23068461 TCCACCAATGATAGACAGACTGG + Intergenic
1053672058 9:40376261-40376283 AGGACCCGTGGGAGACAGACTGG + Intergenic
1053921874 9:43002619-43002641 AGGACCCGTGGGAGACAGACTGG + Intergenic
1054383173 9:64516305-64516327 AGGACCCGTGGGAGACAGACTGG + Intergenic
1054512565 9:66000049-66000071 AGGACCCGTGGGAGACAGACTGG - Intergenic
1056127849 9:83554568-83554590 GGGACCCATGGGAGACAGACTGG + Intergenic
1057845242 9:98517786-98517808 TTGGCCAATGGGAGCCCGGCAGG + Intronic
1059926337 9:119213066-119213088 TAGACCAATGGGAGGCACAAAGG - Intronic
1061242466 9:129382584-129382606 TAGCCCAGTGGGAGACAGAGGGG - Intergenic
1187110792 X:16297711-16297733 TTGATCCATGGGATACAGAATGG + Intergenic
1188705308 X:33321304-33321326 TTGACCCATGGGCTACAGAATGG + Intronic
1188791778 X:34414300-34414322 GGGACCTATGGGAGATAGACTGG - Intergenic
1188869675 X:35358923-35358945 GGGACCTGTGGGAGACAGACTGG + Intergenic
1189066983 X:37820415-37820437 TTGACCAATGAAAAACAGATAGG - Intronic
1189280252 X:39816147-39816169 TTGGCCAATGGGAGGCAGGTAGG - Intergenic
1192254311 X:69442896-69442918 GGGACCCATGGGAGACAGACTGG + Intergenic
1192436019 X:71144435-71144457 TTGACCTTTGGGAGAGTGACAGG + Intergenic
1193496377 X:82218931-82218953 GGGACCTGTGGGAGACAGACTGG + Intergenic
1194080658 X:89460374-89460396 TTTAAAAATGGGAGACAGAATGG - Intergenic
1194854660 X:98914675-98914697 GAGACCCATGAGAGACAGACTGG + Intergenic
1195208112 X:102624629-102624651 GGGACCTGTGGGAGACAGACTGG + Intergenic
1199306987 X:146278932-146278954 GGGACCCATGGGAGACAGACTGG + Intergenic
1200433329 Y:3116438-3116460 TTTAAAAATGGGAGACAGAATGG - Intergenic