ID: 1051822271

View in Genome Browser
Species Human (GRCh38)
Location 9:21181723-21181745
Sequence CGGGTGGGTGGTTGACCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822271_1051822274 -10 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data
1051822271_1051822277 -6 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822277 9:21181740-21181762 CACCCGTCACATCACCAGGCAGG No data
1051822271_1051822278 -5 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822278 9:21181741-21181763 ACCCGTCACATCACCAGGCAGGG No data
1051822271_1051822283 10 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822271_1051822282 9 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822282 9:21181755-21181777 CAGGCAGGGAACCCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822271 Original CRISPR CGGGTGGGTGGTTGACCAAT GGG (reversed) Intergenic
No off target data available for this crispr