ID: 1051822272

View in Genome Browser
Species Human (GRCh38)
Location 9:21181724-21181746
Sequence ACGGGTGGGTGGTTGACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822272_1051822283 9 Left 1051822272 9:21181724-21181746 CCATTGGTCAACCACCCACCCGT No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822272_1051822282 8 Left 1051822272 9:21181724-21181746 CCATTGGTCAACCACCCACCCGT No data
Right 1051822282 9:21181755-21181777 CAGGCAGGGAACCCCTGTCTTGG No data
1051822272_1051822277 -7 Left 1051822272 9:21181724-21181746 CCATTGGTCAACCACCCACCCGT No data
Right 1051822277 9:21181740-21181762 CACCCGTCACATCACCAGGCAGG No data
1051822272_1051822278 -6 Left 1051822272 9:21181724-21181746 CCATTGGTCAACCACCCACCCGT No data
Right 1051822278 9:21181741-21181763 ACCCGTCACATCACCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822272 Original CRISPR ACGGGTGGGTGGTTGACCAA TGG (reversed) Intergenic
No off target data available for this crispr