ID: 1051822273

View in Genome Browser
Species Human (GRCh38)
Location 9:21181735-21181757
Sequence CTGGTGATGTGACGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822273_1051822283 -2 Left 1051822273 9:21181735-21181757 CCACCCACCCGTCACATCACCAG No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822273_1051822289 26 Left 1051822273 9:21181735-21181757 CCACCCACCCGTCACATCACCAG No data
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822273_1051822282 -3 Left 1051822273 9:21181735-21181757 CCACCCACCCGTCACATCACCAG No data
Right 1051822282 9:21181755-21181777 CAGGCAGGGAACCCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822273 Original CRISPR CTGGTGATGTGACGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr